Cells nsect for ABCB1 photolabeling experiments. The membranes were at room temperature with various concentrations of lapatinib in the ATPase assay buffer with IAAP for 5 min at ged buy LY294002 Incubated mpftem light. The samples were photo-crosslinked with UV light of 365 nm for 10 minutes at room temperature. ABCG2 was determined by Immunpr Zipitation Antique Body BXP21 an ABCB1 was immunpr Zipitiert as above, but Dai et al. Page 5 Cancer Res Author manuscript, increases available in PMC 2009 1 October. PA Author Manuscript NIH-PA Author Manuscript NIH Author Manuscript NIH-PA antibody Body C219, which was used. Samples to SDS-PAGE using a gel NuPAGE Trisacetate 7% had been exposed, the gels were dried and with Bio Max MR film at 70 for 8 12 hours.
The radioactivity t in ABCB1 or ABCG2 band was quantified using the Storm 860 recorded PhosphorImager system and ImageQuant. Reverse transcription PCR cells were treated with lapatinib for 48 h. The total cellular Re RNA was isolated by extraction reagent Trizol RNA kit instructions following constructor. cDNA libraries were prepared from drug sensitive and MDR cells. The reverse transcription TGX-221 663619-89-4 was performed with reverse transcriptase. Oligonucleotide primers for ABCB1, ABCG2 and GAPDH were synthesized commercially. The primers used were ABCB1, sense primer, 5, 3 CCCATCATTGCAATAGCAGG, antisense primer, 5, 3 GTTCAAACTTCTGCTCCTGA, ABCG2, sense primer, 5, 3 TGGCTGTCATGGCTTCAGTA, antisense primer, 5, GCCACGTGATTCTTCCACAA 3, GAPDH, sense primer, 5, 3 GAAGGTGAAGGTCGGAGTC, antisense primer, 5, GAAGATGGTGATGGGATTTC 3, using the GeneAmp PCR System 9700, were the reactions for ABCB1, ABCG2 and GAPDH min at 94 for 2 for ANF ngliche denaturation, then 94 for 30 s, 56 s to 30 s and carried out for 72 min for 1.
After 35 cycles of amplification were additionally USEFUL extension at 72 for 10 minutes. The products were gel Subjected st and by means of electrophoresis on a 2% agarose gel. Western blot analysis to determine whether lapatinib affects the formation of ABCB1 or ABCG2 were incubated the cells with various concentrations of lapatinib for 48 h. To test whether lapatinib is blocked k Can act or ERK1 / 2 phosphorylation, we incubated cells with various concentrations of lapatinib for different ZEITR UME. Then the cells were harvested and rinsed twice with PBS.
Cell extracts were incubated with buffer for 30 min produced with occasional rocking and clarified by centrifugation Rt min at 12,000 g for 15 minutes at × fourth Equal amounts of cell lysates were incubated at 37 �� C for 20 min and analyzed by SDS-PAGE and transferred to polyvinylidene fluoride membranes. After the in blocking L Solution diluted with 5% nonfat milk in TBST buffer, 150 mM NaCl and 0.1% Tween 20 for 1 h at 4 membranes were incubated with primary Rem Antique Incubated body fa is appropriate. The expression of GAPDH was used as contr The load. The membranes were then secondary for 1 hour with HRP-conjugated Ren Antique Body incubated in a dilution of 1:1000. The proteins Was verst through Detected markets chemiluminescence detection system. Protein expression was quantified by Scion Image software. Flow cytometry of isolated cell suspensions were fixed by addition of 0.5 mM EDTA, followed by washing three times with PBS buffer isotonic prepared. For EGFR analysis by flow cytometry, approximately 1106 × MCF-7, MCF 7/adr, S1 and S1 80 M1 cells were