Biochemical Pharmacology

DOCK2 contributes to endotoxemia-induced acute lung injury in mice by activating proinflammatory macrophages

Xiaotao Xu a,1, Yang Su b,1, Kaixuan Wu a, Fan Pan a, Aizhong Wang a,*
a Department of Anesthesiology, Affiliated Shanghai Sixth People’s Hospital, Shanghai Jiao Tong University, Shanghai 200233, China
b Department of Anesthesiology, Kaifeng People’s Hospital, Kaifeng 475000, China
A R T I C L E I N F O

Keywords:
DOCK2
Acute lung injury Inflammation Rac
TLR4 IKKβ

A B S T R A C T

Dedicator of cytokinesis 2 (DOCK2), an atypical Rac activator, has important anti-inflammatory properties in blepharitis, enteric bacterial infection and colitis. However, the roles of DOCK2 in macrophage activation and acute lung injury (ALI) are still poorly elucidated. In vitro studies demonstrated that DOCK2 was essential for the nucleotide-sensing Toll-like receptor (TLR) 4-mediated inflammatory response in macrophages. We also confirmed that exposure of macrophages to LPS induced Rac activation through a TLR4-independent, DOCK2- dependent mechanism. Phosphorylation of IκB kinase (IKK) β and nuclear translocation of transcription factor nuclear factor kappa B (NF-κB) were impaired in Ad-shDOCK2-expressing macrophages, resulting in a decreased inflammatory response. Similar results were obtained when EHop-016 (a Rac inhibitor) was used to treat un- infected macrophages. In summary, these data indicate that the DOCK2-Rac signaling pathway acts in parallel with TLR4 engagement to control IKKβ activation for inflammatory cytokine release. Next, we investigated whether pharmacological inhibition of DOCK2 protects against endotoxemia-induced lung injury in mice.
Treatment with 4-[3′-(2′′-chlorophenyl)-2′-propen-1′-ylidene]-1-phenyl-3,5-pyrazolidinedione (CPYPP), a small-
molecule inhibitor of DOCK2, reduced the severity of lung injury, as indicated by decreases in the lung injury score and myeloperoxidase (MPO) activity. Moreover, CPYPP attenuated LPS-induced proinflammatory cytokine release in mice. Our studies suggest that inhibition of DOCK2 may suppress LPS-induced macrophage activation and that DOCK2 may be a novel target for treating endotoxemia-related ALI.

1. Introduction

Acute lung injury (ALI)/acute respiratory distress syndrome (ARDS) is a severe clinical complication characterized by a reduction in pul- monary compliance, an influx of inflammatory cells, such as macro- phages and neutrophils, into lung tissue, and endothelial and epithelial damage [1]. It has been demonstrated that the inflammatory response is divided into two phases in ALI: the acute phase, which is characterized by massive inflammatory cell infiltration and increased production of a variety of oxidants and proteolytic enzymes that increase tissue

destruction [2,3], and the resolution phase, during which phagocytosis of debris and alveolar structural repair occur [4,5]. During the acute phase of ALI, the uncontrolled activation of macrophages is considered as one of the most important factors exacerbating the septic response [6].
Macrophages are indispensable components of innate immunity and play an important role in inflammatory responses. Macrophages may be activated into two phenotypes, the classically activated (M1) phenotype and the alternatively activated (M2) phenotype [7]. Activation of the M1 phenotype, which promotes inflammation, increases oxidative

Abbreviations: ALI, acute lung injury; ARDS, acute respiratory distress syndrome; DOCK2, Dedicator of cytokinesis 2; ROS, reactive oxygen species; TLR4, Toll-like receptor 4; Ad-shDOCK2, adenovirus carrying small hairpin RNA (shRNA) against mouse DOCK2; GEFs, guanine nucleotide exchange factors; PAMPs, pathogen- associated molecular patterns; DAMPs, damage-associated molecular patterns; LPS, lipopolysaccharide; HIV, human immunodeficiency virus; BALF, bronchoalveolar lavage fluid; DOCK2 inhibitor, 4-[3′-(2′′-chlorophenyl)-2′-propen-1′-ylidene]-1-phenyl-3,5-pyrazolidinedione (CPYPP); TLR4 inhibitor, TAK-242; Rac inhibitor,
EHop-016.
* Corresponding author at: Department of Anesthesiology, Shanghai Jiaotong University Affiliated Sixth People’s Hospital, No. 600, Yishan Road, 200233 Shanghai, China.
E-mail address: [email protected] (A. Wang).
1 Xiaotao Xu and Yang Su contributed equally to this work.

Received 5 November 2020; Received in revised form 23 December 2020; Accepted 24 December 2020
Available online 28 December 2020
0006-2952/© 2021 Elsevier Inc. All rights reserved.
stress-induced product levels and tissue injury, is prominent in the acute phase of inflammation. Conversely, activation of the M2 phenotype in- creases the production of anti-inflammatory cytokines, resulting in decreased inflammation and promoting tissue repair, and is important in the resolution of inflammation [8]. Macrophages in the acute phase of ALI are activated through sensing of damage-associated molecular pat- terns (DAMPs) and pathogen-associated molecular patterns (PAMPs) via Toll-like receptors (TLRs). Upon binding of lipopolysaccharide (LPS) to TLR4, macrophages release various inflammatory mediators, including interleukin (IL)-6, IL-1β, tumor necrosis factor-α (TNF-α), inducible ni- tric oxide synthase (iNOS), and cyclooxygenase-2 (COX2), and induce oxidative stress, which ultimately contribute to lung injury [9,10].
Like other Rho family GTPases, Rac functions as a molecular “switch” by cycling between the GDP-bound inactive state and GTP- bound active state. Once activated, Rac interacts with multiple down- stream effectors to be involved in various cellular functions, such as actin reorganization and gene expression. The active GTP-bound Rac is mediated by guanine nucleotide exchange factors (GEFs) [11]. Dedi- cator of cytokinesis 2 (DOCK2) belongs to the dedicator of cytokinesis protein family and is an atypical GEF for the Rho-small guanine tri- phosphatase [12]. Although DOCK2 does not possess the Dbl and pleckstrin homology domains that specifically exist in GEFs, it does contains a DOCK homology region (DHR)-2 domain, which catalyzes the GTP-GDP exchange reaction for Rac [13]. Accumulating evidence sug- gests that DOCK2 regulates the migration of certain subsets of immune cells via Rac activation [14] and plays an important role in the devel- opment of a variety of inflammatory diseases, including allergic diseases and human immunodeficiency virus (HIV) infection [12,15,16]. How- ever, the role of DOCK2 in endotoxemia-induced ALI remains unknown. In this study, we sought to determine whether DOCK2 silencing protects proinflammatory functions in TLR ligand-activated macro- phages. We established macrophages expressing Ad-shDOCK2 to demonstrate the molecular mechanism. Finally, we investigated the biological effect of DOCK2 inhibition on the acute phase of inflamma- tion in a model of septic lung injury induced by LPS to clarify the po- tential limitations of DOCK2 suppression under septic conditions in
clinical practice.

2. Materials and methods

2.1. Reagents and antibodies

LPS (Escherichia coli strain 0111:B4) was obtained from Sigma (St. Louis, MO, USA). EHop-016 was purchased from MedChem Express (catalog no. HY-12810, Princeton, USA)0.4-[3′-(2′′-Chlorophenyl)-2′-
propen-1′-ylidene]-1-phenyl-3,5-pyrazolidinedione(CPYPP) was ob-
tained from MedChem Express (catalog no. HY-110100, Princeton, USA). TAK-242 was purchased from Cayman Chemical (catalog no. 243984-11-4, Michigan, USA). EHop-016, CPYPP and TAK-242 were
dissolved in a solution of 10% DMSO, 40% PEG300, 5% Tween-80 and 45% saline. Antibodies specific for β-actin (1:2000; catalog no. 4970, Cell Signaling Technology, Danvers, MA, USA), ERK (1:1000; catalog no. 4695, Cell Signaling Technology, Danvers, MA, USA), p-ERK (1:1000; catalog no. 8544, Cell Signaling Technology, Danvers, MA, USA), P38 (1:1000; catalog no. 8690, Cell Signaling Technology, Danvers, MA, USA), p-P38 (1:1000; catalog no. 4511, Cell Signaling Technology, Danvers, MA, USA), SAPK/JNK (1:1000; catalog no. 9252, Cell Signaling Technology, Danvers, MA, USA), p-SAPK/JNK (1:1000; catalog no. 9251, Cell Signaling Technology, Danvers, MA, USA), IκB kinase (IKK)-β (1:1000; catalog no. 2684, Cell Signaling Technology, Danvers, MA, USA), phospho-IKKα/β (Ser176/180) (1:1000; catalog no. 2697, Cell Signaling Technology, Danvers, MA, USA), TLR4 (1:200; catalog no. Novus, CA), MyD88 (1:200; catalog no. sc-74532, Santa Cruz Biotech- nology, CA), DOCK2 (1:1000; catalog no. 09-454, Millipore, USA), and Rac1 (1:1000; catalog no. 17-10393, Millipore, USA) were obtained.

2.2. Cell culture

RAW264.7 cells were purchased from the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China) and cultured in RPMI 1640 medium (Gibco, Eggenstein, Germany) supplemented with 10%
fetal bovine serum (FBS; HyClone, Logan, Utah, USA) and 1% penicillin/ streptomycin. Cells were cultured in a 5% CO2 incubator at 37 ◦C.

2.3. Animals

All animal experiments and procedures were performed in accor- dance with the Guide for the Care and Use of Laboratory Animals (eighth edition) published by the National Research Council (USA) and was approved by the Institutional Animal Care and Use Committee of the Sixth People’s Hospital affiliated with Shanghai Jiao Tong University. Specific pathogen-free (SPF) male C57BL/6J mice (Fudan University Medical Animal Center, Shanghai, China) weighing 20–25 g were used.
All animals were housed at a constant room temperature of 22–23 ◦C
with an alternating 12-h light/dark cycle (lights on at 07:00 h) and provided with a standard rodent diet and water ad libitum.

2.4. Transfection and gene silencing

shRNA targeting the mouse DOCK2 gene (NM_033374) were designed and synthesized as complementary antiparallel oligonucleo- tides (oligos) by GeneChem (Shanghai, China). The sequences for Ad- shDOCK2-eGFP and its negative control Ad-eGFP were as follows: Ad- shDOCK2-eGFP: AAGCGGCTTTCTAGAAAGCAA, and negative control Ad-eGFP: TTCTCCGAACGTGTCACGT. The pAd-Max system was used for shRNA delivery. Pairs of oligos were annealed and cloned into the pAD-U6-MCS-CMV-eGFP shRNA vector according to the standard pro- tocol provided by GeneChem (Shanghai, China), and adenoviruses were produced in 293 T cells. Adenoviral packaging and titer determination were performed by GeneChem (Shanghai, China).

2.5. ALI models

Mice were randomized into four groups (n = 6): the saline + vehicle group, LPS + vehicle group, saline + CPYPP group, and LPS + CPYPP group. ALI was induced by intraperitoneal (i.p.) injection of LPS (10 mg/
kg) body weight; E. coli strain 0111:B4; Sigma-Aldrich). The mice in the LPS + vehicle and LPS + CPYPP groups received CPYPP (250 mg/kg) or an equivalent volume of vehicle via i.p. injection 10 min after LPS administration. The mice in the saline + vehicle and saline + CPYPP groups received CPYPP (250 mg/kg) [17] or an equivalent volume of
vehicle via i.p. injection 10 min after saline administration.

2.6. Histological examination of lung injury

Mice were anesthetized with pentobarbital sodium and perfused with cold phosphate-buffered saline (PBS) through the right ventricle. The left lung of mice was removed and fixed with 4% paraformaldehyde for 24 h. After fixation, tissues were embedded in paraffin and sectioned at 5-μm thickness. The sections were stained with hematoxylin and eosin (H&E), and changes in lung morphology were observed under an optical microscope by two pathologists who were blinded to this experiment. Ten areas from each slide were assessed, and lung injury scores were determined based on the following histological features, as described previously [18]: grade 0: normal appearance, no damage; grade 1: mild interstitial congestion and polymorphonuclear leukocyte (PMN) infil- tration; grade 2: perivascular edema, moderate cell infiltration and moderate destruction of the pulmonary architecture; grade 3: massive cell infiltration and moderate lung alveolar damage; and grade 4: severe destruction of the pulmonary architecture and cell infiltration.
2.7. Bronchoalveolar lavage fluid (BALF) preparation and analysis

After mice were sacrificed, the lungs were lavaged 3 times with 0.5 mL of cooled PBS. All removed fluid was centrifuged for 10 min at 1000×g at 4 ◦C immediately. Total cell and differential leukocyte counts
were performed with the hematological analyzer CA-620 (Medonic,
Sweden) and Wright-Giemsa staining (catalog no. D010-1-2, Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The supernatant was stored at -80 ◦C for measurement of the albumin concentration and
cytokine levels.

2.8. Quantification of pulmonary neutrophils and pulmonary edema

The levels of the azurophilic neutrophil granule protein myeloper- oxidase (MPO) were measured with an enzymatic assay as an indicator of PMN infiltration. Whole sections of murine lungs were homogenized in 50 mM potassium phosphate buffer (pH 6.0). The collected super- natant was measured at 405 nm according to the instructions of MPO Activity Kits (catalog no. A044-1-1, Nanjing Jiancheng Bioengineering Institute, China). To quantify pulmonary edema, lung wet/dry weight (W/D) ratios were calculated as described previously [19]. Briefly, the
whole lungs of each mouse were harvested for the determination of the wet weight and then heated to 80 ◦C in an oven for 48 h and reweighed to determine the dry weight.

2.9. Cytokine measurements

The levels of cytokines in serum or cell culture supernatants were measured by enzyme-linked immunosorbent assay (ELISA). Changes in IL-1β, TNF-α, and IL-6 concentrations were determined using commer- cially available ELISA kits (catalog no. SMLB00C; catalog no. SMTA00B; catalog no. SM6000B; R&D Systems, Minneapolis, MN, USA) as described previously [20].

2.10. Total RNA extraction and real-time PCR

Total RNA was extracted from RAW264.7 cells or lung tissue using RNAeasy columns (catalog no. 15055-50; Qiagen, Germany) according to the manufacturer’s instructions. Real-time PCR was performed using SYBR Green Mix (catalog no. RR82LR Takara Bio Inc., Japan) on a deep- well real-time PCR detection system (CFX96 Touch™, Bio-Rad, USA). The specificity of the amplification was examined with melting curve analysis. The comparative Ct (2-ΔΔCt) method was used to determine relative mRNA expression normalized to β-actin expression. The primers used in the study were as follows: TNF-α (CTACCTTGTTGCCTCCTCTTT and GAGCAGAGGTTCAGTGATGTAG), IL-1β (TACTGCTGAGGGCAA- CAAAG and CAGACAGACAGACAGAAGGAAAG), IL-6 (CTAGTGGCA- GACAGAACAGTAAG and AGAGAGACCCATGCCTAACA), DOCK2 (CCGGGATGTGTTCTCCATTT and GGAGCAGTTGTGGCTTCATA), and β-actin (GTGGACATCCGCAAAGAC and AAAGGGTGTAACGCAACTA).

2.11. Immunoblotting

Tissue samples and cells were incubated in RIPA buffer (catalog no. P0013B, Beyotime Institute of Biotechnology, Haimen, China) contain- ing a protease inhibitor (catalog no. 344930, Calbiochem, Schwalbach, Germany). The homogenates were centrifuged at 12000×g for 15 min at
4 ◦C, and the supernatants were collected for subsequent analysis. The
sample concentration was determined using a BCA kit (catalog no. P0012, Beyotime Institute of Biotechnology, Haimen, China). Thirty micrograms of protein were separated on 8–15% SDS-polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) membranes. The blots were blocked with 5% nonfat dry milk for 1 h at room tem-
perature and incubated with the appropriate primary antibodies over- night at 4 ◦C. The blots were washed with 1 × TBST and then incubated with an Anti-rabbit IgG, HRP-conjugated secondary antibody (1:2000;

catalog no. 7074, Cell Signaling Technology, Danvers, MA, USA) for 1 h. The target proteins were detected using an ImageQuant LAS 4000 mini (GE Healthcare Life Sciences, USA) with an enhanced chem- iluminescence (ECL) detection kit (catalog no. WBULS0100, Millipore, USA), and band densities were quantified using ImageJ software (version 4.0.0, USA).

2.12. Immunofluorescence

Lung tissue sections were blocked with 3% goat serum (catalog no. S26-LITER, Millipore, USA) in Tris-buffered saline (TBS) containing 0.1% Triton X-100 for 1 h at room temperature. The slides were incu- bated with an anti-F4/80 antibody (1:100; catalog no. ab254293, Abcam, Cambridge, UK) overnight and then with secondary antibodies for 1 h at room temperature. Nuclei were stained with DAPI (catalog no. C1005, Beyotime Institute of Biotechnology, Haimen, China) for 3 min at room temperature. RAW 264.7 cells were seeded on 24-well glass coverslips and cultured in high-glucose medium supplemented with 10% FBS. After LPS incubation, the cells were washed three times with ice-cold PBS, fixed with paraformaldehyde for 10 min, and then blocked with 3% bovine serum albumin in PBS for 1 h at room temperature. The cells were incubated with anti-TLR4 (1:200; catalog no. NB100- 56580SS, Novus, USA), anti-MyD88 (1:200; catalog no. sc-74532, Santa Cruz Biotechnology, CA) and anti-nuclear factor kappa B (NF- κB) antibodies (1:200; catalog no. 8242, Cell Signaling Technology,
Danvers, MA, USA) at 4 ◦C overnight, washed with 1% PBST three times
and incubated with Alexa Fluor 488-conjugated anti-mouse (1:400; catalog no. ab150113, Abcam, Cambridge, UK) and Alexa Fluor® 594- conjugated anti-rabbit (1:400; catalog no. ab150080, Abcam, Cam- bridge, UK) antibodies for 1 h. F-actin was stained with phalloidin labeled with rhodamine (1:100; catalog no. PHDR1, Cytoskeleton,
Denver, CO, USA) at 37 ◦C for 15 min. Nuclei were stained with DAPI
(catalog no. C1005, Beyotime Institute of Biotechnology, Haimen, China) for 5 min at room temperature, and then the coverslips were washed with PBS three times and observed under a Zeiss LSM 710 confocal microscope (Athens, GA, USA) and Leica DM IL LED inverted microscope (Buffalo Grove, IL, USA), respectively.

2.13. Rac1 pull-down assay

RAW264.7 cells were seeded on a 100-mm cell culture plate. When the cells had grown to approximately 75–80% confluency, they were treated with LPS (1 µg/mL) for 0, 15 or 30 min. To remove the culture medium, the cells were rinsed twice with ice-cold TBS. Then, 0.5 mL of ice-cold Mg2 + Lysis/Wash Buffer (MLB) was added, and the cells were
detached from the plate by scraping with a cell scraper. The lysates were
transferred to microfuge tubes on ice. If nuclear lysis occurred, the extract could be very viscous due to the released genomic DNA. DNA was sheared by passing the lysate through a 26-gauge syringe needle 3–4 times. Then, 100 μL of glutathione agarose per 1 mL of lysate was added,
and the mixture was rocked for 10 min at 4 ◦C. The agarose beads were collected by pulsing for 5 s in a microcentrifuge at 14000×g. The su- pernatant was collected, and 0.5 mL of each cell lysate was added to a
microfuge tube. Then, 10 μL (10 μg) of Rac/cdc42 Assay Reagent (PAK-1 PBD, agarose) per 0.5 mL of cell lysate was immediately added. The reaction mixture was incubated with rotation at 4 ◦C for 60 min. The agarose beads were collected by pulsing for 5 s in a microcentrifuge at
14000×g. The supernatant was discarded, and the beads were washed 3 times with 0.5 mL of MLB. The agarose beads were resuspended in 40 μL of 2 × Laemmli reducing sample buffer and boiled for 5 min. The su- pernatant and the agarose pellet were mixed, and 20 μL of the mixture
was loaded per lane on 15% SDS-polyacrylamide gels, run and trans- ferred to polyvinylidene fluoride (PVDF) membranes. The blots were blocked with 3% nonfat dry milk for 30 min at room temperature and incubated with anti-Rac1 antibodies overnight at 4 ◦C. The blots were
washed with 1 × PBST and then incubated with an HRP-conjugated

1. LPS-induced increase in the expression level of DOCK2 in macrophages and verification of the adenovirus transfection efficiency in macrophages. (A) The level of DOCK2 in LPS-treated macrophages was detected by western blot analysis at the indicated time point. (B) Densitometric analysis of the proteins from (A) was performed with normalization to the respective loading control. (C) The mRNA expression of DOCK2 in macrophages was detected by qPCR. (D) RAW264.7 cells were transfected with an eGFP-expressing adenovirus (Ad-eGFP) or shDOCK2-eGFP-expressing adenovirus (Ad-shDOCK2-eGFP) for 48 h for immunofluorescence detection. The picture presents the transfection of Ad-eGFP or Ad-shDOCK2-eGFP into macrophages. For the cells used, the transfection efficiency of the adenovirus was confirmed by visualizing GFP-expressing cells (scale bar: 100 μm). (E and F) Cells were collected after transfection and subjected to western blot analysis.

Western blot images (E) and quantification (F) of DOCK2 expression in macrophages are shown. (G) The mRNA expression of DOCK2 in macrophages was detected by qPCR. Data are presented as the mean ± SEM of five independent experiments. *P < 0.05.
secondary antibody for 1 h. The blots were detected using an Image- Quant LAS 4000 mini (GE Healthcare Life Sciences, USA) with an ECL detection kit (catalog no. WBULS0100, Millipore, USA).

2.14. Statistical analysis

All data are represented as the mean ± SEM. Statistical analysis was performed with GraphPad Prism 7.00 software (GraphPad Software Inc.,
San Diego, CA, USA). All results were acquired from at least five inde- pendent experiments. We used one-way ANOVA followed by Tukey’s post hoc test when comparing multiple independent groups. An un- paired t-test was used when comparing two different groups. P < 0.05 was considered to be statistically significant.

3. Results

3.1. LPS induced increased expression of DOCK2 in macrophages

First, we investigated whether the level of DOCK2 was increased in LPS-treated macrophages. RAW264.7 cells were treated with 1 µg/mL LPS, and we found that the expression level of DOCK2 in these cells increased in a time-dependent manner ( 1A–C). To determine the role of DOCK2 in LPS-induced inflammatory responses in vitro, RAW264.7 cells were transfected with Ad-shDOCK2-eGFP or Ad-eGFP for 48 h. The efficiency of transfection was detected under a fluores- cence microscope ( 1D). qPCR and western blot results indicated that compared with the uninfected and Ad-eGFP groups, the Ad-shDOCK2-

 2. DOCK2 is required for TLR4-mediated inflammatory cytokine production in macrophages. RAW264.7 cells were transfected with Ad-eGFP or Ad-shDOCK2- eGFP for 48 h and then treated with LPS (1 µg/mL) for 24 h. (A) IL-1β, (B) TNF-α, and (C) IL-6 mRNA levels in macrophages were detected. (D) IL-1β, (E) TNF-α, and

(F) IL-6 protein levels in the supernatant of macrophage cultures were determined. Data are presented as the mean ± SEM of five independent experiments. *P
< 0.05.
eGFP group had markedly reduced levels of DOCK2 in macrophages ( 1E–G).

3.2. DOCK2 is required for TLR4-mediated inflammatory cytokine induction in macrophages

To explore the role of DOCK2 in TLR4-mediated inflammatory cytokine induction in macrophages, we detected the mRNA expression levels of proinflammatory mediators, including IL-1β, IL-6 and TNF-α. RAW264.7 cells were transfected with Ad-shDOCK2-eGFP or Ad-eGFP for 48 h and then exposed to LPS for 24 h. The results showed increased mRNA expression levels for IL-1β, TNF-α and IL-6 in the LPS +
Ad-eGFP group. Conversely, the mRNA expression levels of these

inflammatory cytokines were decreased in the LPS + Ad-shDOCK2-eGFP group ( 2A, B and C). Consistent with these results, the content of IL- 1β, TNF-α and IL-6 in the supernatant of macrophage cultures was also
decreased in the LPS + Ad-shDOCK2-eGFP group compared with the LPS + Ad-eGFP group

3.3. DOCK2 contributes to TLR4-mediated inflammatory cytokine induction via Rac activation

Recent studies have demonstrated that the cytoskeleton plays a vital role in macrophage-, B cell- and dendritic cell-mediated inflammation [21–23]. To explore the mechanism by which DOCK2 controls inflam- matory cytokine induction, Ad-shDOCK2-eGFP- and Ad-eGFP-

. 3. DOCK2 contributes to TLR4-mediated inflammatory cytokine production via Rac activation. RAW264.7 cells were transfected with Ad-eGFP or Ad-shDOCK2- eGFP for 48 h and then treated with LPS (1 µg/mL) for 24 h, or uninfected RAW264.7 cells were incubated with LPS (1 µg/mL) alone or coincubated with LPS and TAK-242 (1 μM) for 24 h. (A) Cells were fixed, permeabilized, and stained with phalloidin for F-actin, and images were acquired by microscopy. Red, phalloidin; blue, DAPI (scale bar: 100 μm). (B) Ad-shDOCK2-eGFP- and Ad-eGFP-expressing macrophages or uninfected macrophages were incubated with LPS (1 µg/mL) for 0, 15, or 30 min. Rac activation at the indicated times was detected by western blot analysis. (C–H) Macrophages were stimulated with LPS (1 µg/mL) alone or costimulated with LPS and EHop-016 (1 μM) for 24 h. Twenty hours later, the IL-1β (C), IL-6 (D) and TNF-α (E) mRNA levels in the macrophages were detected. IL-1β (F), IL-6 (G) and TNF-α (H) protein levels in the supernatant of macrophage cultures were determined. Data are presented as the mean ± SEM of five independent experiments. *P

< 0.05. (For interpretation of the references to colour in this legend, the reader is referred to the web version of this article.)
expressing macrophages were challenged with LPS (1 µg/mL), or unin- fected macrophages were incubated with LPS (1 µg/mL) alone or coin- cubated with TAK-242 (1 μM) [24], a TLR4 inhibitor, for 24 h. The results showed that although Ad-eGFP-expressing macrophages exhibi- ted localized accumulation of F-actin in response to LPS, F-actin as- sembly was rare in Ad-shDOCK2-eGFP-expressing macrophages. The results also demonstrated that after LPS stimulation, TAK-242-treated uninfected macrophages exhibited a polarized morphology with a focused distribution of F-actin ( 3A). Having found that LPS induces actin polymerization via a TLR4-independent, DOCK2-dependent mechanism, we compared Rac activation at the indicated time point among Ad-shDOCK2-eGFP-expressing macrophages, Ad-eGFP- expressing macrophages, and uninfected macrophages exposed to LPS. In response to LPS, Rac was activated in uninfected macrophages treated with TAK-242 to the same extent as in Ad-eGFP-expressing macro- phages. However, LPS-induced Rac activation was almost totally abol- ished in Ad-shDOCK2-eGFP-expressing macrophages at 15 min and 30 min ( 3B). To directly examine whether Rac activation is involved in

inflammatory cytokine release by macrophages, macrophages were stimulated with LPS (1 µg/mL) alone or costimulated with LPS and EHop-016 (1 μM) [25], a Rac inhibitor, for 24 h. Compared with the LPS group, the EHop-016 group exhibited remarkably suppressed LPS- induced inflammatory cytokine release (3C–H). These results indi- cate that DOCK2 contributes to TLR4-mediated inflammatory cytokine generation in macrophages through Rac activation.
3.4. Interaction of TLR4 with MyD88 is not impaired in Ad-shDOCK2- eGFP-expressing macrophages

We next determined whether DOCK2 interferes with TLR4 signaling, which induces NF-κB activation via MyD88-dependent pathways and MyD88-independent pathways in macrophages [26]. The results showed that a strong TLR4-MyD88 association was observed in the LPS + Ad- eGFP group within 15 min. DOCK2 silencing did not inhibit the asso-
ciation of MyD88 with TLR4 (4). Thus, DOCK2 does not inhibit the interaction of TLR4 with MyD88 to prevent NF-κB activation.

 4. DOCK2 silencing does not prevent the LPS-induced interaction of TLR4 with MyD88. RAW264.7 cells were transfected with Ad-eGFP or Ad-shDOCK2-eGFP for 48 h and then treated with LPS (1 µg/mL) for 15 min, or uninfected RAW264.7 cells were incubated with LPS (1 µg/mL) for 15 min. The cells were washed, fixed, permeabilized, and stained, and images were obtained by microscopy. Green, MyD88; red, TLR4; blue, DAPI. Strong colocalization of TLR4 with MyD88 was observed after LPS challenge, and this response was not inhibited by DOCK2 silencing (scale bar: 5 μm). Data are presented as the mean ± SEM of five independent

experiments. *P < 0.05. (For interpretation of the references to colour in this  legend, the reader is referred to the web version of this article.)
3.5. DOCK2-mediated Rac activation is critical for IKK-β activation in macrophages

NF-κB activation plays an important role in regulating the expression of proinflammatory mediators and oxidative stress induced by LPS [27,28]. Recent evidence indicates that NF-κB activation is controlled by the IKK complex and MAPKs [29]. Given that MAPK signaling cascades participate in the production of inflammatory mediators and oxidative stress by activating NF-κB [30,31], we investigated the phosphorylation levels of ERK, JNK, and p38. The results showed that the levels of phosphorylated JNK, ERK and p38 were obvious at 30 min and then decreased gradually ( 5A, B, C and D). To determine the role of DOCK2 in mediating the LPS-induced phosphorylation of inflammatory signaling pathway MAPKs in macrophages, Ad-shDOCK2-eGFP- and Ad- eGFP-expressing macrophages were stimulated with LPS (1 µg/mL) for 30 min. We found that in response to LPS, ERK, JNK, and p38 were

phosphorylated in Ad-shDOCK2-eGFP-expressing macrophages to the same extent as in Ad-eGFP-expressing macrophages ( 5E, F and H). The IKK complex is composed of IKK-α and IKK-β, which activate NF-κB by controlling its nuclear translocation and transactivation. Ser536 phosphorylation in the p65 transactivation domain is mediated by IKK-α and IKK-β. IKK-β also induces the phosphorylation of IκBα (at Ser32), which leads to its dissociation and degradation, permitting NF-κB release and subsequent cytokine and ROS production [32,33]. In Ad- eGFP-expressing macrophages, IKK-β was phosphorylated in response to LPS. However, this phosphorylation was hardly detectable in both Ad- shDOCK2-eGFP-expressing macrophages and uninfected macrophages treated with TAK-242. Moreover, IKK-β phosphorylation was inhibited by EHop-016 in uninfected macrophages ( 6A and B). Collectively, these results suggest that DOCK2-mediated Rac activation controls in- flammatory cytokines, at least in part, through phosphorylation and activation of IKK-β. Furthermore, we also examined the nuclear

 5. DOCK2 silencing does not affect the LPS-induced activation of MAPKs in macrophages. Macrophages were stimulated with 1 µg/mL LPS and collected at the indicated time points. (A) The levels of phosphorylated MAPKs were detected by western blot analysis. (B-D) Densitometric analysis of the phosphorylated MAPKs from (A) was performed with normalization to the respective total protein. RAW264.7 cells were transfected with Ad-eGFP or Ad-shDOCK2-eGFP for 48 h and then treated with LPS (1 µg/mL) for 30 min, or uninfected RAW264.7 cells were incubated with LPS (1 µg/mL) for 30 min. (E) The levels of phosphorylated MAPKs were detected by western blot analysis. (F-H) Densitometric analysis of the phosphorylated MAPKs from (E) was performed with normalization to the respective total

protein. Data are shown as the mean ± SEM of five independent experiments, *P < 0.05.
translocation of NF-κB by staining macrophages with DAPI and an anti- NF-κB antibody. In Ad-eGFP-expressing macrophages, the nuclear translocation of NF-κB was increased in response to LPS. However, such nuclear translocation of NF-κB was difficult to observe in both Ad- shDOCK2-eGFP-expressing macrophages and uninfected macrophages treated with TAK-242. In addition, the nuclear translocation of NF-κB was inhibited by EHop-016 in uninfected macrophages (6C). These results indicate that DOCK2 is critical for IKK-β phosphorylation- induced nuclear translocation through Rac activation in macrophages.

3.6. Endotoxemia-induced lung injury and changes in DOCK2 in lung tissue

We showed that DOCK2 was required for the LPS-induced inflam- matory response in macrophages in vitro. We then asked whether DOCK2 has similar activity in vivo. First, we challenged mice with 10 mg/kg LPS by i.p. injection and measured lung injury using H&E staining and neutrophil sequestration by assaying lung tissue MPO ac- tivity. At 6 h after LPS administration, mice showed significantly greater lung injury score and MPO activity than at 0 h. In contrast, at 24 h after

LPS challenge, the lung injury score and MPO activity both started to decrease ( 7A–C). Furthermore, we evaluated whether DOCK2 is aberrantly expressed during endotoxemia-induced ALI. We found that the expression of DOCK2 was increased in the lung tissues of LPS- challenged mice and that the level of DOCK2 was highest at 6 h

3.7. Pharmacological inhibition of DOCK2 alleviates endotoxemia- induced ALI

We next examined the effect of pharmacological DOCK2 inhibition on endotoxemia-induced ALI. We intraperitoneally administered CPYPP, an inhibitor of the DOCK2-Rac1 interaction, to mice [17]. Mice received i.p. injections of vehicle or CPYPP (250 mg/kg of body weight) 10 min after LPS administration. Twelve hours after LPS injection, we found that LPS led to significant histological changes in the lungs, including inflamma- tory cell infiltration, alveolar wall thickening and pulmonary congestion, which were remarkably attenuated in CPYPP-treated mice ( 8A). Accordingly, CPYPP-treated mice had decreased lung injury scores compared with vehicle-treated mice  Furthermore, CPYPP-

 6. DOCK2-mediated Rac activation is critical for IKK-β activation in macrophages. RAW264.7 cells were transfected with Ad-eGFP or Ad-shDOCK2-eGFP for 48 h and then treated with LPS (1 µg/mL) for 15 min, or uninfected RAW264.7 cells were coincubated with LPS and TAK-242 (1 μM) or with LPS and EHop-016 (1 μM) for 15 min. (A) Cells were analyzed to assess the phosphorylation of IKK-β using western blot analysis. (B) Densitometric analysis of phosphorylated IKK-β from (A) was performed with normalization to the respective total protein. (C) Translocation of NF-κB in cells was detected by immunofluorescence. Red, NF-κB; blue, DAPI (scale bar: 5 μm). Data are presented as the mean ± SEM of five independent experiments. *P < 0.05. (For interpretation of the references to colour in this  legend, the reader is referred to the web version of this article.)
treated mice exhibited significantly decreased MPO activity and W/D ratios, which indicated decreased pulmonary edema

3.8. Pharmacological inhibition of DOCK2 ameliorates inflammatory responses in endotoxemia-induced ALI in mice

Next, we explored the effects of DOCK2 on endotoxemia-induced inflammatory responses in mice. The results indicated that CPYPP effectively decreased the secretion and gene expression of TNF-α, IL-1β and IL-6 in the lungs  Moreover, CPYPP remarkably inhibi- ted the infiltration of total cells, macrophages and neutrophils into the BALF  To detect the number of macrophages in lung tis- sues, we examined the expression of F4/80, a marker of macrophages, and found its expression was reduced in CPYPP-treated mice . Overall, these results illustrate that DOCK2 inhibition alleviates in- flammatory responses in endotoxemia-induced ALI in mice.

4. Discussion

Uncontrolled inflammatory responses are thought to play essential roles in the pathogenesis of ALI [34,35]. In this study, we provide in

vitro and in vivo evidence that DOCK2 silencing ameliorates LPS- induced ALI by depressing the inflammatory response. We found that in vitro, DOCK2 contributes to LPS-induced proinflammatory cytokine release by acting in parallel with TLR4 engagement to control IKK-β activation in macrophages. Additionally, our data showed that phar- macological inhibition of DOCK2 attenuated lung destruction and inhibited inflammatory cell infiltration and proinflammatory cytokine release in endotoxemia-induced ALI mice in vivo. These results demonstrated that DOCK2 could be considered a potential target for the treatment of ALI in the future.
The control of cytoskeletal dynamics by DOCK2, a member of the conserved family of GEFs, has been implicated in TCR signaling and T cell migration [36], and DOCK2 has been identified as a central regu- lator of lymphocyte and plasmacytoid dendritic cell migration control- ling Rac-dependent actin polymerization and cytoskeletal reorganization in these cells [11,37,38]. DOCK2 plays important roles in diverse immune cell processes. Convincing evidence supports the prin- cipal roles of DOCK2 in controlling innate and adaptive immune re- sponses [39,40]. It has been reported that DOCK2 is involved in the development of various inflammatory diseases and tissue injury, such as allergic diseases induced by Leishmania major infection, T and B cell

7. Acute lung injury was induced by endotoxemia in mice. Mice were intraperitoneally injected with LPS (10 mg⋅kg-1) and sacrificed at the indicated time

points. (A) H&E staining was used to assess lung injury (scale bar: 100 μm). (B) Lung injury scores were determined from four independent parameters. (C) MPO activity was detected by ELISA. (D) The expression levels of DOCK2 in lung tissues were detected by western blot analysis. Each band corresponds to an individual animal. (E) Densitometric analysis of the proteins from (D) was performed with normalization to the respective loading control. (F) The mRNA expression of DOCK2 in lung tissues was detected by qPCR. Data are presented as the mean ± SEM, n = 6 mice per group. *P < 0.05 compared with 0 h.

8. Pharmacological inhibition of DOCK2 prevents endotoxemia-induced lung injury in mice. Mice received i.p. injections of vehicle or CPYPP (250 mg/kg of body weight) via intraperitoneal injection 10 min after LPS administration and were sacrificed 12 h after LPS injection. (A) Lung injury was assessed by H&E staining (scale bar: 100 μm). (B) Lung injury scores were determined from four independent parameters. (C) MPO activity in mouse lungs, an indicator of neutrophil infiltration, was determined. (D)W/D ratios of mouse lungs, an indicator of pulmonary edema, were measured. Data are presented as the mean ± SEM, n = 6 mice per

group. *P < 0.05.

 

9. Pharmacological inhibition of DOCK2 attenuates the inflammatory response in mice with endotoxemia-induced ALI. Mice received i.p. injections of vehicle or CPYPP (250 mg/kg of body weight) via intraperitoneal injection 10 min after LPS administration. Twelve hours later, the mRNA levels of IL-1β (A), TNF-α (B), and IL- 6 (C) in the lungs were detected with real-time PCR. The serum expression levels of IL-1β (D), TNF-α (E), and IL-6 (F) were determined with ELISA. Data are presented as the mean ± SEM, n = 6 mice per group. *P < 0.05.
combined immunodeficiencies, and inflammatory bowel disease [12,15,16]. DOCK2 deficiency in recipients also prolongs the survival of cardiac allografts by inhibiting the activation of naïve T cells in sec- ondary lymphoid organs and decreasing graft tissue infiltration by activated T cells, further supporting the role of DOCK2 in exacerbating the adaptive immune response [41]. Whether pharmacological inhibi- tion of DOCK2 can protect against ALI still needs to be explored. The present study focused on the role of DOCK2 in endotoxemia-induced ALI in mice, and we found that DOCK2 inhibition attenuated the inflam- matory response induced by LPS.
It has been reported that TLR4 plays a vital role in the pathological process of ALI and has an extremely important relationship with respi- ratory inflammation [42]. TLR4, a receptor for LPS, plays an indis- pensable role in immune responses to bacterial infections. TLR4 can be activated by LPS and subsequently triggers downstream signaling cas- cades, which can upregulate the gene expression of proinflammatory cytokines, such as IFNγ, TNF-α, and IL-1β [43]. According to previous studies, inhibition of the TLR4/MyD88/NF-κB pathway lessens oxida- tive stress, inflammation and mitochondrial dysfunction in LPS-induced

ALI mice [44]. In this study, our results indicate that DOCK2 is critical for TLR4-mediated proinflammatory cytokine release in macrophages. In addition, this study also demonstrated that when NF-κB was acti- vated, the level of phosphorylated IKK-β but not those of phosphorylated MAPKs were obviously different between the LPS + Ad-eGFP and LPS +
Ad-shDOCK2-eGFP group. This indicates that NF-κB activation by
DOCK2 is independent of the MAPK signaling pathway and dependent on the IKK complex.
Rac, as one of the major members of the Rho family, is involved in cytoskeletal remodeling, cell migration, gene transcription, cell prolif- eration and cell survival. Accumulating studies have shown that Rac activation may promote tumorigenesis, which is associated with in- flammatory pathways [45]. Studies have shown that Rho GTPases are important factors that play a vital role in TLR signaling pathways and that Rac1 induces NF-κB activation, which leads to massive release of proinflammatory cytokines [46,47]. Meanwhile, Rac1 activation plays an important role in maintaining endothelial monolayer integrity by stabilizing intercellular junctions and by formation of cortical actin [48,49]. It is important to note, however, that the role of Rac1 activation

 

10. Pharmacological inhibition of DOCK2 markedly decreases the total cell, neutrophil and macrophage counts in the BALF and macrophage infiltration into lung tissue in endotoxemia-induced ALI in mice. Mice received i.p. injections of vehicle or CPYPP (250 mg/kg of body weight) via intraperitoneal injection 10 min after LPS administration. Twelve hours later, total cells (A), macrophages (B) and neutrophils (C) in the BALF were detected. (D) F4/80 (in red) and DAPI (blue) double staining in the lungs were determined by immunofluorescence (scale bar: 100 μm). Data are presented as the mean ± SEM, n = 6 mice per group. *P < 0.05.
(For interpretation of the references to colour in this legend, the reader is referred to the web version of this article.)
in ALI has been inconsistent across studies. Some studies have shown that Rac1 activation exert a protective role in ALI. For instance, inhi- bition of adenosine deaminase with Pentostatin significantly enhanced endothelial basal barrier function, an effect that was also associated with enhanced Rac1 GTPase activity, and played a protective role in α-naphthylthiourea-induced a non-inflammatory ALI model [50]. Sphingosine-1-phosphate (S1P) can offer protection against LPS- induced endothelial barrier disruption regulated by Rac1 activation in human lung microvascular endothelial cells (HLMVECs) [51]. In contrast, specific inhibition of Rac activities by NSC23766 not only inhibited neutrophil transwell migration toward a chemoattractant, fMLP, but also reduced Evans Blue and albumin accumulation in LPS- challenged lungs and further alleviated lung injury [52]. NSC23766 also significantly decreased inflammasome activation and macrophage infiltration and attenuated lung injury in neonatal rats exposed to hyperoxia [53]. Rac1 is involved in endothelial barrier recovery and Rac1 inhibition induced endothelial integrity disruption during the resolution phase of sepsis-associated ALI yyy [54]. However, in our study, we focus on the earlier phase of sepsis-associated ALI, demon- strating that CPYPP alleviated sepsis-induced ALI through inhibiting Rac1 activation. Our results also showed that TLR4-mediated IKK-β activation was severely impaired in Ad-shDOCK2-eGFP-expressing macrophages and uninfected macrophages pretreated with a Rac in- hibitor and indicated that the Rac inhibitor could restrain the trans- location of NF-κB and further decrease proinflammatory cytokine release. The contradictory effect of Rac1 activation in ALI may be due to explore different phase of ALI, diffferrent animal models and different cells (endothelial cell and macrophage) of ALI.
There is increasing evidence that the inflammatory response con- tributes to the pathogenesis of ALI. Understanding the molecular mechanisms that regulate the inflammatory response and targeting the DOCK2-Rac signaling pathway in parallel with TLR4 engagement to control IKK-β activation for proinflammatory cytokine release could reveal novel ways to treat ALI.

Author contributions

X.X. designed and performed most of the experiments, analyzed and interpreted the data, and wrote the manuscript. Y.S., K.W. and F.P. assisted during the acquisition, analysis, and interpretation of data and revised the manuscript. X.X. and K.W. assisted with data acquisition and manuscript revision. A.W. is responsible for the integrity of the work as a whole. All authors reviewed and approved the final version of the manuscript.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

The authors thank Ms. Yunyun Wang (China-Japan Union Hospital of Jilin University, Changchun, China) for providing technical assistance.

Fundings

This work was supported by the National Natural Science Foundation of China (81370974 and 81500056).

References

[1] C.C. Hardin, K. Hibbert, ECMO for severe ARDS, N. Engl. J. Med. 378 (21) (2018) 2032–2034.
[2] G. Matute-Bello, C.W. Frevert, T.R. Martin, Animal models of acute lung injury, Am. J. Physiol. Lung Cell. Mol. Physiol. 295 (3) (2008) L379–L399.

[3] B.T. Thompson, R.C. Chambers, K.D. Liu, Acute respiratory distress syndrome,
N. Engl. J. Med. 377 (6) (2017) 562–572.
[4] L.K. Johnston, C.R. Rims, S.E. Gill, J.K. McGuire, A.M. Manicone, Pulmonary macrophage subpopulations in the induction and resolution of acute lung injury, Am. J. Respir. Cell Mol. Biol. 47 (4) (2012) 417–426.
[5] S. Gea-Sorli, R. Guillamat, A. Serrano-Mollar, D. Closa, Activation of lung macrophage subpopulations in experimental acute pancreatitis, J. Pathol. 223 (3) (2011) 417–424.
[6] D.J. Stearns-Kurosawa, M.F. Osuchowski, C. Valentine, S. Kurosawa, D.G. Remick, The pathogenesis of sepsis, Annu. Rev. Pathol. 6 (2011) 19–48.
[7] A. Sica, A. Mantovani, Macrophage plasticity and polarization: in vivo veritas,
J. Clin. Invest. 122 (3) (2012) 787–795.
[8] A. Mantovani, S.K. Biswas, M.R. Galdiero, A. Sica, M. Locati, Macrophage plasticity and polarization in tissue repair and remodelling, J. Pathol. 229 (2) (2013)
176–185.
[9] T. Kawai, S. Akira, Toll-like receptors and their crosstalk with other innate receptors in infection and immunity, Immunity 34 (5) (2011) 637–650.
[10] H. Lv, Z. Yu, Y. Zheng, L. Wang, X. Qin, G. Cheng, X. Ci, Isovitexin exerts anti- inflammatory and anti-oxidant activities on lipopolysaccharide-induced acute lung injury by inhibiting MAPK and NF-kappaB and activating HO-1/Nrf2 pathways, Int. J. Biol. Sci. 12 (1) (2016) 72–86.
[11] Y. Fukui, O. Hashimoto, T. Sanui, T. Oono, H. Koga, M. Abe, A. Inayoshi, M. Noda,
M. Oike, T. Shirai, T. Sasazuki, Haematopoietic cell-specific CDM family protein DOCK2 is essential for lymphocyte migration, Nature 412 (6849) (2001) 826–831.
[12] X. Guo, S.Y. Chen, Dedicator of cytokinesis 2 in cell signaling regulation and disease development, J. Cell. Physiol. 232 (8) (2017) 1931–1940.
[13] E. Brugnera, L. Haney, C. Grimsley, M. Lu, S.F. Walk, A.C. Tosello-Trampont, I.
G. Macara, H. Madhani, G.R. Fink, K.S. Ravichandran, Unconventional Rac-GEF activity is mediated through the Dock180-ELMO complex, Nat. Cell Biol. 4 (8) (2002) 574–582.
[14] C. Nombela-Arrieta, T.R. Mempel, S.F. Soriano, I. Mazo, M.P. Wymann, E. Hirsch,
A.C. Martinez, Y. Fukui, U.H. von Andrian, J.V. Stein, A central role for DOCK2 during interstitial lymphocyte motility and sphingosine-1-phosphate-mediated egress, J Exp Med 204(3) (2007) 497-510.
[15] Y. Chen, F. Meng, B. Wang, L. He, Y. Liu, Z. Liu, Dock2 in the development of inflammation and cancer, Eur. J. Immunol. 48 (6) (2018) 915–922.
[16] A. Janardhan, T. Swigut, B. Hill, M.P. Myers, J. Skowronski, HIV-1 Nef binds the DOCK2-ELMO1 complex to activate rac and inhibit lymphocyte chemotaxis, PLoS Biol. 2 (1) (2004) E6.
[17] A. Nishikimi, T. Uruno, X. Duan, Q. Cao, Y. Okamura, T. Saitoh, N. Saito, S. Sakaoka, Y. Du, A. Suenaga, M. Kukimoto-Niino, K. Miyano, K. Gotoh, T. Okabe, F. Sanematsu, Y. Tanaka, H. Sumimoto, T. Honma, S. Yokoyama, T. Nagano, D. Kohda, M. Kanai, Y. Fukui, Blockade of inflammatory responses by a small- molecule inhibitor of the Rac activator DOCK2, Chem Biol 19(4) (2012) 488-97.
[18] S. Vettorazzi, C. Bode, L. Dejager, L. Frappart, E. Shelest, C. Klassen, A. Tasdogan,
H.M. Reichardt, C. Libert, M. Schneider, F. Weih, N. Henriette Uhlenhaut, J.P. David, M. Graler, A. Kleiman, J.P. Tuckermann, Glucocorticoids limit acute lung inflammation in concert with inflammatory stimuli by induction of SphK1, Nat Commun 6 (2015) 7796.
[19] T. Eckle, L. Fullbier, M. Wehrmann, J. Khoury, M. Mittelbronn, J. Ibla,
P. Rosenberger, H.K. Eltzschig, Identification of ectonucleotidases CD39 and CD73 in innate protection during acute lung injury, J. Immunol. 178 (12) (2007) 8127–8137.
[20] G.Y. Sun, H.H. Yang, X.X. Guan, W.J. Zhong, Y.P. Liu, M.Y. Du, X.Q. Luo, Y. Zhou,
C.X. Guan, Vasoactive intestinal peptide overexpression mediated by lentivirus attenuates lipopolysaccharide-induced acute lung injury in mice by inhibiting inflammation, Mol. Immunol. 97 (2018) 8–15.
[21] B. Diesel, J. Hoppstadter, N. Hachenthal, R. Zarbock, C. Cavelius, B. Wahl,
N. Thewes, K. Jacobs, A. Kraegeloh, A.K. Kiemer, Activation of Rac1 GTPase by nanoparticulate structures in human macrophages, Eur. J. Pharm. Biopharm. 84
(2) (2013) 315–324.
[22] W. Song, C. Liu, A. Upadhyaya, The pivotal position of the actin cytoskeleton in the initiation and regulation of B cell receptor activation, BBA 1838 (2) (2014)
569–578.
[23] Y.R. Chen, F. Feng, L. Wang, S.Y. Qu, Z.Q. Zhang, L. Liu, H.Y. Qin, Y.M. Liang,
H. Han, Deletion of RBP-J in dendritic cells compromises TLR-mediated DC activation accompanied by abnormal cytoskeleton reorganization, Mol. Biol. Rep. 40 (2) (2013) 1531–1539.
[24] G. Carpino, M. Del Ben, D. Pastori, R. Carnevale, F. Baratta, D. Overi, H. Francis, V. Cardinale, P. Onori, S. Safarikia, V. Cammisotto, D. Alvaro, G. Svegliati-Baroni, F. Angelico, E. Gaudio, F. Violi, Increased liver localization of lipopolysaccharides in human and experimental non-alcoholic fatty liver disease, Hepatology (2019).
[25] L. Castillo-Pichardo, T. Humphries-Bickley, C. De La Parra, I. Forestier-Roman, M. Martinez-Ferrer, E. Hernandez, C. Vlaar, Y. Ferrer-Acosta, A.V. Washington, L.A. Cubano, J. Rodriguez-Orengo, S. Dharmawardhane, The Rac Inhibitor EHop-016 Inhibits Mammary Tumor Growth and Metastasis in a Nude Mouse Model, Transl Oncol 7(5) (2014) 546-55.
[26] E. Andreakos, S.M. Sacre, C. Smith, A. Lundberg, S. Kiriakidis, T. Stonehouse,
C. Monaco, M. Feldmann, B.M. Foxwell, Distinct pathways of LPS-induced NF- kappa B activation and cytokine production in human myeloid and nonmyeloid cells defined by selective utilization of MyD88 and Mal/TIRAP, Blood 103 (6) (2004) 2229–2237.
[27] Q. Li, I.M. Verma, NF-kappaB regulation in the immune system, Nat. Rev. Immunol. 2 (10) (2002) 725–734.
[28] M.C. Lu, J. Zhao, Y.T. Liu, T. Liu, M.M. Tao, Q.D. You, Z.Y. Jiang, CPUY192018, a
potent inhibitor of the Keap1-Nrf2 protein-protein interaction, alleviates renal
inflammation in mice by restricting oxidative stress and NF-kappaB activation, Redox Biol. 26 (2019).
[29] J.S. Shin, H.T. Im, K.T. Lee, Saikosaponin B2 suppresses inflammatory responses through IKK/IkappaBalpha/NF-kappaB signaling inactivation in LPS-induced RAW
264.7 macrophages, Inflammation 42 (1) (2019) 342–353.
[30] T. Ban, G.R. Sato, A. Nishiyama, A. Akiyama, M. Takasuna, M. Umehara, S. Suzuki,
M. Ichino, S. Matsunaga, A. Kimura, Y. Kimura, H. Yanai, S. Miyashita, J. Kuromitsu, K. Tsukahara, K. Yoshimatsu, I. Endo, T. Yamamoto, H. Hirano, A. Ryo,
T. Taniguchi, T. Tamura, Lyn Kinase Suppresses the Transcriptional Activity of IRF5 in the TLR-MyD88 Pathway to Restrain the Development of Autoimmunity, Immunity 45(2) (2016) 319-32.
[31] M. Zhou, W. Xu, J. Wang, J. Yan, Y. Shi, C. Zhang, W. Ge, J. Wu, P. Du, Y. Chen, Boosting mTOR-dependent autophagy via upstream TLR4-MyD88-MAPK signalling and downstream NF-kappaB pathway quenches intestinal inflammation and oxidative stress injury, EBioMedicine 35 (2018) 345–360.
[32] F. Christian, E.L. Smith, R.J. Carmody, The regulation of NF-kappaB subunits by phosphorylation, Cells 5 (1) (2016).
[33] D. Li, X. Wang, Q. Huang, S. Li, Y. Zhou, Z. Li, Cardioprotection of CAPE-oNO2 against myocardial ischemia/reperfusion induced ROS generation via regulating the SIRT1/eNOS/NF-kappaB pathway in vivo and in vitro, Redox Biol. 15 (2018) 62–73.
[34] Y. Zhou, T. Liu, J.X. Duan, P. Li, G.Y. Sun, Y.P. Liu, J. Zhang, L. Dong, K.S.S. Lee, B.
D. Hammock, J.X. Jiang, C.X. Guan, Soluble epoxide hydrolase inhibitor attenuates lipopolysaccharide-induced acute lung injury and improves survival in mice, Shock 47 (5) (2017) 638–645.
[35] K.T. Cheng, S. Xiong, Z. Ye, Z. Hong, A. Di, K.M. Tsang, X. Gao, S. An, M. Mittal, S.
M. Vogel, E.A. Miao, J. Rehman, A.B. Malik, Caspase-11-mediated endothelial pyroptosis underlies endotoxemia-induced lung injury, J. Clin. Invest. 127 (11) (2017) 4124–4135.
[36] V.S. Mahajan, E. Demissie, F. Alsufyani, S. Kumari, G.J. Yuen, V. Viswanadham,
A. Huang, J.Q. Tran, J.J. Moon, D.J. Irvine, S. Pillai, DOCK2 sets the threshold for entry into the virtual memory CD8(+) T cell compartment by negatively regulating tonic TCR triggering, J. Immunol. 204 (1) (2020) 49–57.
[37] T. Sanui, A. Inayoshi, M. Noda, E. Iwata, J.V. Stein, T. Sasazuki, Y. Fukui, DOCK2 regulates Rac activation and cytoskeletal reorganization through interaction with ELMO1, Blood 102 (8) (2003) 2948–2950.
[38] K. Gotoh, Y. Tanaka, A. Nishikimi, A. Inayoshi, M. Enjoji, R. Takayanagi,
T. Sasazuki, Y. Fukui, Differential requirement for DOCK2 in migration of plasmacytoid dendritic cells versus myeloid dendritic cells, Blood 111 (6) (2008) 2973–2976.
[39] S.K. Ippagunta, R.K. Malireddi, P.J. Shaw, G.A. Neale, L. Vande Walle, D.R. Green,
Y. Fukui, M. Lamkanfi, T.D. Kanneganti, The inflammasome adaptor ASC regulates the function of adaptive immune cells by controlling Dock2-mediated Rac activation and actin polymerization, Nat. Immunol. 12 (10) (2011) 1010–1016.
[40] [40] Y. Jing, D. Kang, L. Liu, H. Huang, A. Chen, L. Yang, P. Jiang, N. Li, H. Miller,
Z. Liu, X. Zhu, J. Yang, X. Wang, J. Sun, Z. Liu, W. Liu, X. Zhou, C. Liu, Dedicator of cytokinesis protein 2 couples with lymphoid enhancer-binding factor 1 to regulate expression of CD21 and B-cell differentiation, J Allergy Clin Immunol 144(5) (2019) 1377-1390 e4.
[41] H. Jiang, F. Pan, L.M. Erickson, M.S. Jang, T. Sanui, Y. Kunisaki, T. Sasazuki,
M. Kobayashi, Y. Fukui, Deletion of DOCK2, a regulator of the actin cytoskeleton in

lymphocytes, suppresses cardiac allograft rejection, J. Exp. Med. 202 (8) (2005) 1121–1130.
[42] H. Go, J. Koh, H.S. Kim, Y.K. Jeon, D.H. Chung, Expression of toll-like receptor 2 and 4 is increased in the respiratory epithelial cells of chronic idiopathic interstitial pneumonia patients, Respir. Med. 108 (5) (2014) 783–792.
[43] J. Wang, Y. Gao, F. Lin, K. Han, X. Wang, Omentin-1 attenuates lipopolysaccharide (LPS)-induced U937 macrophages activation by inhibiting the TLR4/MyD88/NF- kappaB signaling, Arch. Biochem. Biophys. 679 (2020).
[44] W.B. Zhang, F. Yang, Y. Wang, F.Z. Jiao, H.Y. Zhang, L.W. Wang, Z.J. Gong, Inhibition of HDAC6 attenuates LPS-induced inflammation in macrophages by regulating oxidative stress and suppressing the TLR4-MAPK/NF-kappaB pathways, Biomed. Pharmacother. 117 (2019).
[45] B. Schmeck, S. Huber, K. Moog, J. Zahlten, A.C. Hocke, B. Opitz, S. Hammerschmidt, T.J. Mitchell, M. Kracht, S. Rosseau, N. Suttorp, S. Hippenstiel, Pneumococci induced TLR- and Rac1-dependent NF-kappaB-recruitment to the IL- 8 promoter in lung epithelial cells, Am J Physiol Lung Cell Mol Physiol 290(4) (2006) L730-L737.
[46] J. Liu, S. Guo, K. Jiang, T. Zhang, W. Zhiming, Y. Yaping, Y. Jing, A. Shaukat,
G. Deng, miR-488 mediates negative regulation of the AKT/NF-kappaB pathway by targeting Rac1 in LPS-induced inflammation, J. Cell. Physiol. (2019).
[47] P. Angkeow, S.S. Deshpande, B. Qi, Y.X. Liu, Y.C. Park, B.H. Jeon, M. Ozaki,
K. Irani, Redox factor-1: an extra-nuclear role in the regulation of endothelial oxidative stress and apoptosis, Cell Death Differ. 9 (7) (2002) 717–725.
[48] J.R. Jacobson, S.M. Dudek, P.A. Singleton, I.A. Kolosova, A.D. Verin, J.G. Garcia, Endothelial cell barrier enhancement by ATP is mediated by the small GTPase Rac and cortactin, Am. J. Physiol. Lung Cell. Mol. Physiol. 291 (2) (2006) L289–L295.
[49] G. Su, A. Atakilit, J.T. Li, N. Wu, M. Bhattacharya, J. Zhu, J.E. Shieh, E. Li, R. Chen,
S. Sun, C.P. Su, D. Sheppard, Absence of CPYPP integrin alphavbeta3 enhances vascular leak in mice by inhibiting endothelial cortical actin formation, Am. J. Respir. Crit. Care Med. 185 (1) (2012) 58–66.
[50] Q. Lu, E.O. Harrington, J. Newton, B. Casserly, G. Radin, R. Warburton, Y. Zhou, M.
R. Blackburn, S. Rounds, Adenosine protected against pulmonary edema through transporter- and receptor A2-mediated endothelial barrier enhancement, Am. J. Physiol. Lung Cell. Mol. Physiol. 298 (6) (2010) L755–L767.
[51] Y. Zhao, I.A. Gorshkova, E. Berdyshev, D. He, P. Fu, W. Ma, Y. Su, P.V. Usatyuk,
S. Pendyala, B. Oskouian, J.D. Saba, J.G. Garcia, V. Natarajan, Protection of LPS- induced murine acute lung injury by sphingosine-1-phosphate lyase suppression, Am. J. Respir. Cell Mol. Biol. 45 (2) (2011) 426–435.
[52] H.Y. Yao, L. Chen, C. Xu, J. Wang, J. Chen, Q.M. Xie, X. Wu, X.F. Yan, Inhibition of Rac activity alleviates lipopolysaccharide-induced acute pulmonary injury in mice, BBA 1810 (7) (2011) 666–674.
[53] J.K. Hummler, F. Dapaah-Siakwan, R. Vaidya, R. Zambrano, S. Luo, S. Chen, N. Kerr, J.P. de Rivero Vaccari, R.W. Keane, W.D. Dietrich, E. Bancalari, K.C. Young,
S. Wu, Inhibition of Rac1 Signaling Downregulates Inflammasome Activation and Attenuates Lung Injury in Neonatal Rats Exposed to Hyperoxia, Neonatology 111
(3) (2017) 280-288.
[54] T. Wang, M. Yegambaram, C. Gross, X. Sun, Q. Lu, H. Wang, X. Wu, A. Kangath,
H. Tang, S. Aggarwal, S.M. Black, RAC1 nitration at Y(32) IS involved in the endothelial barrier disruption associated with lipopolysaccharide-mediated acute lung injury, Redox Biol. 38 (2020).