trypsin and 37 w During 30 minutes. After brief stirring, 1 ml of K Added calf serum and the cells were collected by sedimentation. The cell pellet was resuspended in 5 ARQ 197 ml of medium 254 containing a drop of FCS. The cells were grown in a 25 flask and fed three times T w Weekly with medium containing 254 PMA without additional USEFUL cultured human growth hormone melanocytes. Secondary Re cultures of neonatal melanocytes were L These cells from prime Ren culture dishes with trypsin EDTA and reseeding cells obtained at low cell density. For storage, the melanocytes were frozen in liquid nitrogen at 1 107 cells per ml in serum-free medium CS C cryopreservation. Four different melanocyte cultures were established for these studies.
Culture fifth foreskin melanocytes were purchased from Cambrex Corporation, Walkersville, MLN8054 MD. A culture was melanocytes with a replication-defective retrovirus, HPV16E6 oncoprotein p53 expression or a dominant-negative, as well as a gene transduced neomycinresistance infected. The infected cells were. By growth for 2 weeks in a culture medium containing 400 g ml G418 selected Melanoma cell lines were obtained from different sources, and grown as recommended by the supplier. All melanocytes and melanoma cell lines were performed with the Gen-Probe Mycoplasma tested ? Kit acc the manufacturer’s recommended protocol. Cell lines with more than twice the background RLU as contaminated with mycoplasmas were treated with Plasmocin, according to manufacturer’s recommended protocol, and then retested.
There are no reported data for contaminated cultures. The diplomatic F1 hTERT fibroblast human lineage derived from foreskin and in these studies, as described above. Medical ethics boards of the University of North Carolina at Chapel Hill and the University of Rochester approved all studies described. The study was conducted in accordance with the Declaration of Helsinki protect ground Performed. Mutation analysis of B and N RAF RAS BN RAF mutation status was determined from genomic DNA of all melanoma cell lines.
Genomic DNA was isolated from the cells using genomic tips kits and following the manufacturer’s recommended protocol, the mutation status of the RAF B exons 11 and 15, and N RAS isolated at codons 12, 13, 18 and 61 was determined as follows: PCR amplification using the following primers: B RAF exon 15, for: 5 TCATAATGCTTGCTCTGATAGGA 3 rev: 5 GGCCAAA AATTTAA TCAGTGGA 3, B RAF exon 11 for: 5 CTGTTTGGCTTGACTTG AC 3, rev: 5 GACTTGTCACAATGTCACC 3, N RAS at codons 12 , 13 and 18 for 3 5 ATACACAGAGG AAGCCTTC: 5 GACTGAGTACAAACTG GTGG 3 rev: 5 GGGCCTCACCTCTATGGTG 3 NRAS at codon 61, to: 5 GGTGAAACCTGTTTGTTGGA 3 rev PCR products were purified from agarose gels and DNA was 2 3100 using the PCR primer on the front of the University of North Carolina at Chapel Hill Fund automated DNA sequencer lacing on a Genetic Analyzer. Quantification of DNA Sch The checkpoint functions G1 and G2 exponential growth of cells in flask holder were irradiated with 1.5 Gy 137Cs gamma rays at a dose of 0.9 Gy per minute. Embroidered Shamtreated were the same movements to and from the irradiation device, however without undergoing irradiation. To quantify the funct checkpoint G1