After three PBS washes, slices were incubated in PBS during 1 hr at room temperature and incubated 2 hr at room temperature with the secondary antibody: Alexa-488 goat anti-chicken (1:1,000, Molecular Probes) or Cyanine 3 donkey anti-rat, anti-mouse, or anti-rabbit (1:500, Jackson ImmunoResearch). Slices were then treated as described elsewhere (Dufour et al., 2003). Analyses GDC 973 were performed using a Zeiss Axioplan fluorescence microscope or a Zeiss

LSM510 confocal microscope. For immunohistochemistry, paraffin sections 4 μm thick were incubated at 98°C for 30 min in sodium citrate buffer (10 mM sodium citrate, 0.2% Tween 20, pH 6.0). The sections were immersed in 0.2% hydrogen peroxide for 30 min and preincubated in a humid chamber in PBS plus 5% horse serum with 0.3% Tween 20 for 30 min at room temperature, followed by overnight incubation with goat-ephrinB1 (1:40, R&D Systems) at 4°C. The sections were incubated with biotinylated rabbit anti-goat immunoglobulin G (5.0 mg/ml), followed by an avidin-biotin

peroxidase complex, and developed by immersing in DAB substrate according to the manufacturer’s instructions (Vectastain Elite ABC kit, Vector). The specificity of the staining was verified by incubation without the primary or secondary antibodies. Mouse ephrin-B1 complementary DNA (with or without Myc-tag sequence) SNS-032 manufacturer was cloned into pCAG-IRES-GFP (pCIG) plasmid using XhoI/HindIII restriction sites. Ephrin-B1T was deleted for the last 72 amino acids, fused in frame with enhanced green fluorescent protein sequence, and cloned into pCAG-IRES-RFP plasmid using XhoI/HindIII restriction sites. pEGFP plasmids with GFP-tagged

WT or dominant-negative human Prex1 and Myc-tagged WT from or ΔPDZ human Prex1 are a kind gift of M. Hoshino (Kyoto University Graduate School of Medicine). N-terminal 3× Flag-tagged WT and dominant-negative (T17N) human Rac3 in pCDNA3.1 were a kind gift from J. Collard (The Netherlands Cancer Institute). They were amplified by PCR, sequence verified, and cloned into pCIG using XhoI and EcoRI restriction sites. B1S37 EfnB1 S37D (A358G) was generated by PCR from pCIG-EfnB1 (F primer: ctcgagatggcccggcctgggca; R primer: tttgaattccaggcccatgtagtCggggctgaactcttg), sequence verified, and cloned back into pCIG-EfnB1 with XhoI (within pCIG multiple cloning site) and EcoRI (within EfnB1 coding sequence). For adhesion assays, embryos were in utero electroporated with pCIG or pCIG-EfnB1 at E14.5 as described earlier.