Different susceptibility as a function of growth stage was also observed in the Ply700 endolysin [46], which is more active against early and mid-exponential Streptococcus uberis cells. Another feature that is characteristic of HydH5 and other phage structural hydrolases is their thermostability, most likely related to a Rabusertib manufacturer high refolding capability. HydH5 retained 72% of its activity after a 5-min treatment at 100°C. Likewise, the structural lysozyme from phage phiKMV infecting Ps. aeruginosa is also a highly thermostable protein, retaining 26% of its activity after 2 h at 100°C

and 21% after autoclaving [47]. By contrast, the lytic activity of most phage endolysins is destroyed by heat treatment [35, 41]. This makes structural PG hydrolases attractive Cell Cycle inhibitor antimicrobials to be used in combination with other hygienic procedures based on high temperature such as those applied in food preservation and as structural models for highly thermostable enzymes. Conclusions The lytic activity of HydH5, the virion-associated PG hydrolase from phage phiIPLA88, is due to the presence of two active catalytic domains, namely, an N-terminal CHAP domain and a C-terminal LYZ2 domain. HydH5 lysed S. aureus cells in the absence of divalent cations and this activity was optimal against early

exponential ML323 cells and at 45°C. These characteristics along with its thermostability provide it a potential to be applied as antimicrobial against S. aureus. Methods Bacteria, phages and growth conditions S. aureus Sa9 was isolated from mastitic milk and routinely cultivated in 2 × YT broth at 37°C [22]. E. coli DH10B (Gibco, BRL), E. coli BL21 (DE3)/pLysS [50] and E. coli Rosetta DE3 (Novagen, Madison, USA) were cultivated in 2 × YT broth at 37°C. E. coli transformants were selected with 100 μg/ml ampicillin and/or 25 μg/ml chloramphenicol. Bacteriophage vB_SauS-phiIPLA88 (phiIPLA88) was routinely

propagated on S. aureus Sa9 [22]. DNA manipulations and plasmids construction Plasmid DNA was obtained with the High Pure Plasmid Isolation Kit (Roche Diagnostics stiripentol GmbH, Mannheim, Germany). Analytical and preparative gel electrophoresis of plasmid DNA and restriction fragments was carried out in 0.8% (w/v) agarose-Tris-Acetate horizontal slab gels. Phage phiIPLA88 DNA was extracted and purified as described previously [51]. PCR amplifications were carried out using the PureTaq™ Ready-To-Go™ PCR Beads kit (GE Healthcare, England, United Kingdom) and the PCR fragments were purified using the GenElute PCR clean-up kit (Sigma Missouri, USA). The full-length N-terminally 6×His-tagged protein HydH5 (671 amino acids) was obtained as follows. The primers H1F (5′- GATTGAAATGGGATCCATACATGGG -3′) and H2R (5′- CACACCTCTGAATTCATATTTATCTCTTG -3′) were annealed to template phiIPLA88 DNA.