Louis, MO, USA). Real-time primer pairs were designed using ABI software to amplify a sequence that contains two or more exons whenever possible. The amplification CP673451 efficiencies of the primers used were above 90%. The specific sequences for each pair of primers are listed in Table 1. β-actin was amplified as an internal control. The real-time qPCR reaction conditions were set at 95°C for 10 min followed by 40 cycles at 95°C for 15 s and 60°C for 60 s. The results were analyzed using the comparative cycle threshold

(Ct) method as previously described [35]. The expression level of each gene was normalized to a β-actin (ΔCt) and the fold changes for each gene were calculated by comparing the test and control samples from the ΔΔCt values. Table 1 Nucleotide sequence of real-time qPCR primers Primers Sequence (5′-3′) MMP1-F ATG CTG AAA CCC TGA AGG TG MMP1-R CTG CTT GAC CCT CAG AGA CC MMP2-F AGG GCA CAT CCT ATG ACA GC MMP2-R ATT TGT TGC CCA GGA AAG TG MMP3-F GCA GTT TGC TCA GCC TAT CC MMP3-R GAG TGT CGG AGT CCA GCT TTC TIMP1-F CTG TTG TTG CTG TGG CTG AT TIMP1-R TCC GTC CAC AAG CAA TGA

GT β-actin -F TTG GCA ATG AGC GGT T β-actin -R AGTTGAAGGTAGTTTCGTGGAT Total protein extraction and detection of MMP-3 by ELISA Total proteins were extracted from homogenized HGFs using CellLyticTM MT-mammalian cell lysis extraction reagent (Sigma, USA). Protein concentrations in both of the cell-bound fraction and culture supernatant were Captisol measured respectively by BCA protein assay kit (Pierce, Thermo Scientific, USA) according to the manufacturer’s instructions. Enzyme-linked immunosorbent assay (ELISA) was performed to confirm the expression of MMP-3 proteins (BioRad Laboratories, Hercules, CA, USA). The protein expression in both cell this website lysate and culture supernatants were measured following manufacturer’s instruction with the minimal detectable concentration of 0.009 ng/ml. No cross reactivity or no interference was observed with recombinant MMP-3. The absorbance values were determined by a micro-plate reader (Victor,

Vienna, VA, Dimethyl sulfoxide USA) at optical absorbance of 450 nm and the final concentration was determined with reference to a standard curve. Experiments were repeated two times with three biological replicates. Western blot analysis for MMP-2, -3 and TIMP-1 proteins Total cell lysates were prepared and 40 μg of cellular extracts were separated by 10% SDS-PAGE gel and subsequently transferred onto a polyvinylidene difluoride membrane (PVDF). The proteins were then blocked against the protein-free blocking buffer (Pierce, Thermo Scientific) for 1 h. Afterwards, membranes were incubated overnight at 4°C with primary antibodies against polyclonal rabbit anti-human IgG; MMP-2 (1:1000; Cell signaling), MMP-3 (1:1000; BioVendor) and TIMP-1 (1:1000; Cell signaling), and incubated with horseradish peroxidase (HRP) conjugated anti-rabbit secondary antibodies (1:10000).