43 (Chow et al. 1988). This corresponds to 59% Chl of PSII and 41% Chl of PSI. If all the PSIIs are closed, one might expect 59% Chl contribution of slow lifetimes

and 41% of fast lifetime. The amplitudes of the lifetime of 116 ps for both groups of pixels is more than 41%, so the conclusion should be such that not all the PSII reaction centers are closed by the DCMU. The two slow lifetimes of ~1 and ~4 ns must correspond to closed PSII reaction centers because these lifetimes are absent for open RCs. The 6.3% difference in the amplitude of the slow lifetimes for the high- and low-intensity Autophagy activator pixels is probably caused by the fact that the high-intensity pixels comprise more PSII than PSI. This is expected because the grana, where PSII is concentrated, have a higher chlorophyll concentration per pixel than the stroma lamellae. There are two straightforward explanations for the lifetime differences in the pixel groups: (i) The DCMU buffer is not penetrated evenly in every part of the chloroplasts which results in different lifetimes and intensities for each pixel; (ii) In one pixel group, there are more grana than in the other pixel group which will also result in different lifetimes and intensities for each pixel. In Fig. 6b, the

intensity of the different pixels seems to have a random distribution in the chloroplast, which is not expected as a result of varying penetration of the DCMU buffer. The differences in lifetimes for Copanlisib nmr only the two pixel groups can thus better be explained by pixels with more or less grana. It should be kept in mind that the model that is used here (PSI and PSII fluorescence kinetics are both homogeneous) is oversimplified, for instance, because of the action of the PSII repair cycle and the presence of PSII heterogeneity. In conclusion, it appears to

be very difficult to distinguish between regions with more or less grana. Fig. 5 Room temperature fluorescence decay traces (measured with FLIM). The chloroplasts in Arabidopsis thaliana leaves are excited with TPE at 860 nm and are detected with a bandpass filter centered at 700 nm with a bandwidth of 75 nm. Black squares represent a “”normal”" fluorescence decay trace of chloroplasts in an Arabidopsis leaf with an average lifetime of 290 ps. Round open circles represent a fluorescence decay trace of a vacuum infiltrated leaf with a 0.1 mM DCMU buffer with an average lifetime of 1.3 ns Fig. 6 a Room temperature fluorescence decay traces (measured with FLIM) of chloroplasts in Alocasia wentii leaves excited with TPE at 860 nm detected with a bandpass filter centered at 700 nm with a bandwidth of 75 nm. The leaves are vacuum infiltrated with a 0.1 mM DCMU buffer for closing the PSII reaction centers. The black (1) trace with its fit corresponds to the summed fluorescence decay of 10 white (high) pixels from the chloroplast in the intensity-based image in Fig. 6b.

In this study, a large audiometric dataset of 29,216 construction workers is used to describe their hearing status. The effect of noise exposure on hearing is observed by comparing hearing threshold levels of noise-exposed workers to thresholds of references. The relationship between hearing and noise intensity and noise exposure time is examined, with particular interest in the hearing loss established during the first 10 years of noise exposure. The measured relationships are compared to ISO-1999 predictions. In addition, the influence of wearing hearing protection and other factors collected in periodic occupational health surveys on NIHL is considered.

Methods This cross-sectional study is based on data collected by Arbouw, the Dutch national institute on occupational health and safety in the construction industry. These data

are derived from medical records of periodic occupational ABT-888 in vitro health examinations (POHE), performed between 1 November 2005 and 20 July 2006 throughout The Netherlands. A POHE consists of an extensive self-administered questionnaire and a physical examination, including standardized audiometric testing. POHEs are provided for all employees in the construction industry, irrespective of occupational noise exposure. The right to participate is laid down in the collective labour agreement, and participation is completely voluntary. Demographic, see more occupational and health-related data are extracted anonymously from the medical records. This includes information regarding job title, use of HPDs (yes/no), self-reported hearing complaints, noise disturbance at work and the number of years employed in both the construction industry and the current occupation. Cigarette Tenoxicam smoking status (non-/ex-/current smoker) alcohol intake (gl/wk) and blood pressure are also recorded.

Hypertension is defined as systolic blood pressure ≥ 140 mmHg combined with diastolic blood pressure ≥ 90 mmHg (De Moraes Marchiori 2006). Independent ethical approval is not needed for this type of retrospective analyses in the Netherlands. Participants The eligible study population contains all 29,216 construction workers who had undergone a POHE in the given period. Hearing threshold levels of the noise-exposed construction workers are compared to different reference groups, in order to separate the effects of occupational noise from those due to ageing and other non-occupational causes of hearing loss. The ISO-1999 standard provides two reference databases: database A, based on a highly screened non-noise-exposed population free from otologic disease, which is used in this study to correct for median age-related hearing loss; and annex B, an alternative database representing a typical otologically unscreened population of an industrialized country, not occupationally exposed to noise. This database derived from representative population-based samples can serve as an appropriate comparison group (Dobie 2006).

Proper function of ABCB4 is critical for maintaining hepatobiliary homeostasis as

evidenced by the myriad of diseases that occur when polymorphisms of ABCB4 cause complete or partial protein dysfunction. ABCB4 deficiency is associated with a variety of hepatobiliary disorders in people including progressive familial intrahepatic cholestasis (PFIC type 3), cholelithiasis, and cholestasis of pregnancy [4, 8–10]. Abcb 4-/- mice, in which Abcb 4 function is lacking entirely, also develop severe hepatobiliary disease that starts at a few weeks of age and Fluorouracil mw progresses throughout life [11, 12]. Hepatobiliary disease in dogs has been recognized with increased frequency during the past several years. In particular, gallbladder mucoceles (mucinous hyperplasia or mucinous cholecystitis) EGFR activity have been documented to be an increasingly important cause of hepatobiliary disease in dogs [13–15]. Histopathologic findings associated with ABCB4 associated diseases in people, including intrahepatic cholestasis, cholecystitis, and periportal inflammation [13, 16, 17], are not commonly reported in dogs with gall bladder mucoceles. Additionally, gallbladder mucoceles are not a component of ABCB4 linked syndromes in people or mice. Gallbladder mucoceles, which occur rarely in people, are often associated with extrahepatic bile duct obstruction. The etiology

of gallbladder mucoceles in dogs has not yet been identified, but extrehepatic bile duct obstruction is not commonly associated with this disorder [14, 15]. Gallbladder mucoceles may result from chronic injury to the epithelial lining of the biliary system since hypersecretion of mucin is the typical physiologic

Staurosporine research buy response of any epithelial lining to injury. Recently Shetland Sheepdogs were identified as a breed that is predisposed to gallbladder mucocele formation, suggesting a genetic predisposition [13]. Because ABCB4 dysfunction is associated with hepatobiliary disease in people and mice, we postulated that a defect in canine ABCB 4 might be responsible for gallbladder mucocele disease in dogs, and Shetland Sheepdogs in particular. Therefore, we sequenced canine ABCB 4 in affected and unaffected Shetland Sheepdogs as well as affected and unaffected dogs of other breeds. Methods Collection of DNA from affected and unaffected individuals All work was approved by the institutional Animal Care and Use Committee. Collection of DNA from affected Shetland Sheepdogs was accomplished by soliciting owners’ cooperation. In order to cast a wide net, owners of dogs with confirmed (ultrasound, surgery, or histopathology) or suspected (elevated liver enzymes – alkaline phosphatase, alanine aminotransferase and/or gamma glutamyl transferase -, total bilirubin, cholesterol and/or triglycerides) gallbladder disease were asked to submit a cheek swab, copy of the dog’s pedigree, and copy of the dog’s medical record. Contact of Shetland Sheepdog owners was made through the American Shetland Sheepdog Association.

The other three fragments (E3, E4 and E5 corresponding to nucleotide 690-3101, 3090-5437 and 5425 to the 3′-end) were produced by PCR with primer

pairs E3/E3′, E4/E4′, E5/E5′. Cycling parameters for three PCRs were as follows: initial denaturation at 94°C for 1 min, 30 cycles of 98°C for 20 s, 68°C for 3 min, and then 72°C for 10 min. The E3, E4 and E5 amplicons were cloned into the M-pSK vector with XbaI/PstI, PstI/EcoRI, and EcoRI/NotI sites, the resulting positive plasmids were designated pSKE3, pSKE4, and pSKE5, respectively. ABC294640 The M-pSK vector derived from pBluescriptSK (+) by removed T7 promoter and modified some restriction enzyme sites in the vector sequence, was synthesized by GenScript Biotech Company (Nanjing, China). To introduce the genetic tags into the genome of Asia1/JSp1c8, recombinant plasmid pSKE3Δ, which contained two synonymous mutations (1185A→G, 1185T→C) to eliminate the EcoRI site in the E3 fragment, were constructed by oligonucleotide-directed mutagenesis with PCR amplification of the parent plasmid pSKE3 using p1/p1′primer pair. PCR amplification was carried out for 18 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 1 min, and extension at 68°C for 8 min. All recombinant plasmids were confirmed by complete DNA sequencing.

learn more Primers used to construct full-length cDNA clones of Asia1/JSp1c8 are listed in table 5. Figure 5 Strategy used to construct FMDV Asia1/JSp1c8 full-length cDNA clone, pRDD. The location of restriction enzyme cleavage sites used to assemble the subcloned RT-PCR fragments (E1, E2, E3, E4, E5 and E12) are shown (numbered relative to nucleotide position in the virus genome). Thick lines and an open box represent the untranslated regions ADAMTS5 and the open-reading frame for the viral polyprotein, respectively. The thin line represents the vector sequence. FMDV cDNA is under the control of the T7 promoter. Table 5 Sequences of the primers used for the construction of a full-length cDNA clone and mutants of FMDV Asia1/JSp1c8 Name Nucleotide Sequence (5′→3′) Nucleotide Position (nt) E1 CAGGATCC TAATACGACTCACTATAGGGTTGAAAAGG GGCGCTAGGGTC 1-21 E1′ TAAAACTTAGGGGGGGGGGGGGGGGGGGGTGAAAG

361-390 E2 TTTCACCCCCCCCCCCCCCCCCCCCTAAGTTTTAC 362-391 E2′ CCTCTAGA CCTGGAAAGACCAGGC 677-700 E3 AGGTCTAGAGGGGTGACATTTTGT 690-713 E3′ GTCTGCAGCAGAAAGGTAAGGGAT 3078-3101 E4 CTGCTGCAGACTATGCTTACACTG 3090-3113 E4′ AAAGAATTC AATTGCTGCCTCATG 5414-5437 E5 AATTGAATTCTTTGAGGGAATGGTGCAC 5425-5452 E5′ TTGCGGCCGCTTT(38) 3′end P1 ACAAGGAAAGATGGAGCTCACACTTCACAAC 1168-1198 P1′ GTTGTGAAGTGTGAGCTCCATCTTTCCTTGT 1168-1198 TR1 ACTGCATTCATTCTGAGTGGGA 2960-2984 TR1′ GGCAAGATCACCACGCCGCGAGGA 3679-3703(D→G) TR2 TCCTCGCGGCGTGGTGATCTTGCC 3679-3703(D→G) TR2′ 5′-GAAGAAACTCGAGGCGACTTTGAC-3′ 4342-4366 TR3 TCCTCGCGGCGTAGTGATCTTGCC 3679-3703(D→S) TR3′ GGCAAGATCACTACGCCGCGAGGA 3679-3703(D→S) Nucleotide positions of primers used for cloning are shown: numbering according to Asia1/JS/CHA/05 (Genbank Accession: EF149009).

37 ± 1.09). Transcript levels after treatment with H2O2 were similar as those observed in untreated cells (Figure 6B). One possibility for this result is that in the absence of ArcA, ArcB might phosphorylate (i.e ArcB-OmpR, [43]) one or more response regulators, either unspecifically or due to cross-talk, which could bind to the promoter region and therefore Selleck Romidepsin prevent binding of positive regulators like SoxS, which has been demonstrated to regulate ompW

and is up-regulated in response to HOCl [20, 44]. This could result in constant ompW transcript levels as shown in Figure 6A. On the other hand, in the absence of ArcB no phosphorylation occurs and SoxS or other positive regulator(s) might have free accessibility to the ompW promoter and therefore increase its expression (Figure 6B), although this possibility has not been evaluated in this study. Genetic complementation of ∆arcB restored the negative regulation

observed in wild type cells exposed to H2O2 and HOCl (0.19 ± 0.04 and 0.24 ± 0.11, respectively, Figure 6C). The ompD and ompC transcripts levels remained down-regulated after exposure BTK inhibitor to H2O2 and HOCl in the ∆arcB strain, while the negative control arcA remained unaltered (Figure 6B). The ArcA regulon in anaerobically grown S. Typhimurium was recently determined [27]. Interestingly, neither ompD nor ompW expression was down-regulated in an ArcA dependant manner, suggesting that the ArcA regulon under anaerobic and aerobic ROS conditions could be different. Even in E. coli ompW expression is suggested to be regulated by FNR in response to oxygen availability [39]. The difference between the ArcA regulons under aerobic and ROS conditions might be explained by studies

suggesting that the mechanism of ArcA activation under aerobic conditions is different from those classically described. E. coli mutant strains in residue H-717 of ArcB are able to phosphorylate and activate ArcA through the transfer of the phosphate group from residue His-292 under aerobic conditions [45] and Loui et al. (2009) suggested that H2O2 resistance is independent of ArcA phosphorylation at residue Asp-54. To the date, the detailed molecular mechanism of ArcAB activation in response to ROS remains unsolved. Therefore, further experiments to unveil the molecular mechanism by which ifenprodil the S. Typhimurium ArcAB two component system is activated are needed and under way in our laboratory. Conclusion We provide both genetic and biochemical evidence indicating that the OM porin OmpW mediates the influx of H2O2 and HOCl. The results revealed that the S. Typhimurium ompW gene is negatively regulated upon exposure to both toxic compounds. Furthermore, we demonstrate that the response regulator ArcA mediates ompW negative regulation in response to H2O2 and HOCl via a direct interaction with the upstream region of ompW.

Comparative gut metagenomics using 16S rRNA gene sequences We performed comparative metagenomics on 16S rRNA gene sequences derived

from publicly available gut metagenomic datasets to reveal phylotype differences between mammalian, avian, and invertebrate distal gut microbiomes. The distribution of bacterial phyla from swine feces appeared closest to that of the cow rumen and chicken cecum, sharing more similar proportions of Bacteroidetes, Firmicutes, Proteobacteria, and Actinobacteria (Figure 2). A statistical analysis comparing bacterial distribution between hosts revealed several significantly different bacterial groups. (Additional File 2, Table S1 and S2). Human adult and infant distal gut microbiomes had significantly higher abundances of Actinobacteria (p < 0.05) than did the swine microbiome (Additional File 2, Table S2). The selleck kinase inhibitor fish gut microbiome was comprised mostly of Proteobacteria and Firmicutes, while the termite gut was dominated by Spirochetes. Interestingly, the swine fecal metagenome also harbored significantly more Spirochetes than many other hosts. (Additional File 2, Selleck AZD9668 Table S3). Figure 2 Taxonomic distribution of bacterial phyla from swine and other currently available gut microbiomes within MG-RAST.

The percent of sequences assigned to each bacterial order from swine and other gut metagenomes is shown. Using the “”Phylogenetic Analysis”" tool within MG-RAST, each gut metagenome was searched against the RDP and greengenes databases using the BLASTn algorithm. The percentage of each bacterial phlya from swine, human infant, and human adult metagenomes were each averaged since there was more than one metagenome for each of these hosts within the MG-RAST database. The e-value cutoff for 16S rRNA gene hits to the RDP and greengenes databases was 1×10-5 with a minimum alignment length of 50 bp. Among the Bacteroidetes, Prevotella were significantly more abundant in the swine fecal metagenome when compared to all other gut metagenomes (p < 0.05), with the exception of the cow rumen, while Bacteroides species were more abundant in chicken and human distal gut microbiomes (Figure

3). Additionally, Anaerovibrio and Treponema genera were exclusively found within the pig fecal metagenomes. Hierarchical clustering of phylotype distribution ADP ribosylation factor (genus-level) from each gut microbiome revealed that community structure of the swine fecal microbiome was significantly different (p < 0.05) from the other gut microbiomes (Figure 4A). Of all the microbiomes used in the comparative analysis, the swine metagenomes exhibited the highest resemblance to the cow rumen, displaying 59% similarity at the genus level. Surprisingly, swine fecal community structure (genus-level) was less than 40% similar to any of the human fecal microbiomes used in this study. Figure 3 Taxonomic distribution of bacterial genera from swine and other currently available gut microbiomes within MG-RAST.

[20] However, the treatment period was longer and the response rate was lower in patients with dacryocystitis than in patients with other infections. As discussed above, treatment of dacryocystitis with an ophthalmic solution alone seems to be insufficient. This is because the duration of dacryocystitis is often longer than those of other ocular infections; dacryocystitis is often relapsing in nature; and https://www.selleckchem.com/products/FK-506-(Tacrolimus).html surgical treatments, such as dacryocystorhinostomy, are often necessary for the treatment of this disease, as it can obstruct the nasolacrimal duct.[21] As for the dosing frequency of levofloxacin 0.5% ophthalmic solution, it was higher in patients with bacterial corneal ulcers than in patients

with other ocular diseases. This is because if corneal ulcers are aggravated, visual disorders may occur. Because of this, the Japanese guidelines on management of infectious keratitis, which were made public in October 2007, recommend CP-690550 supplier frequent application

of antimicrobial ophthalmic solution in patients with severe infectious keratitis.[22] This study also indicates that when treating bacterial corneal ulcers, treatment can be completed within 8 days in half of all cases if levofloxacin 0.5% ophthalmic solution is applied 4–6 times daily. Increasing the frequency of dosing of levofloxacin 0.5% ophthalmic solution did not elevate the incidence of ADRs. Conclusion This post-marketing surveillance of levofloxacin 0.5% ophthalmic solution (Cravit® ophthalmic solution), conducted over 4 years, confirms the safety and efficacy Nintedanib (BIBF 1120) of levofloxacin 0.5% ophthalmic solution in regular clinical use and highlights that it is a promising treatment for a variety of external ocular bacterial infections. Acknowledgments This study was originally published in Japanese in Rinsho Ganka, the Japanese Journal of Clinical Ophthalmology.[23] The study has been reproduced here in English with kind permission of the publisher of Rinsho Ganka, Igaku-Shoin Ltd. The authors would like to thank Simone Boniface of inScience Communications, Springer Healthcare, who provided medical writing assistance (funded by Santen

Pharmaceutical Co., Ltd.); Akio Nomura of Santen Pharmaceutical Co., Ltd., for reviewing and editing the paper; and the healthcare professionals who participated in this study and gave their cooperation with the survey and supply of valuable data. At the time when this research was conducted, all authors were employees of Santen Pharmaceutical Co., Ltd., which manufactures the product described in this research. References 1. Cravit® ophthalmic solution: prescribing information. Osaka: Santen Pharmaceutical Co., Ltd., 2005 Oct 2. Rose P. Management strategies for acute infective conjunctivitis in primary care: a systematic review. Expert Opin Pharmacother 2007 Aug; 8(12): 1903–21PubMedCrossRef 3. Une T, Fujimoto T, Sato K, et al.

2010). Because of their slow growth, lichens cannot compete effectively against vascular plants but, in areas with extreme abiotic conditions such as long periods of drought or cold, higher plants are excluded and lichens fill this important niche (Lalley et al. 2006). The symbiotic life form of lichens is composed of a fungal (mycobiont) and an photosynthetic partner (photobionts), and the latter can be an eukaryotic green alga (chlorobiont) and/or a cyanobacterium (cyanobiont). The ability of mycobionts to switch photobionts (Nelsen and Gargas

2009; Otalora et al. 2010; Henskens et al. 2012) and associate with more than one photobiont species or genotype along a climatic gradient appears to be a mechanism used by lichens to adapt to particular habitats. This has been reported for crustose lichens (Blaha et selleck al. 2006; Muggia et al. 2008; Ruprecht et al. 2012) and for fruticose lichens (Kroken and Taylor 2000). The influence of photobiont selection on the ecological amplitude of lichens is still largely underexplored Panobinostat mouse (Peksa and Skaloud 2011) and shedding more light on this phenomenon would help towards understanding structure,

composition and development of BCSs (Bowker 2007; Lazaro et al. 2008). The research reported here is part of the international and interdisciplinary SCIN-Project (Soil Crust InterNational; please see Büdel et al. 2014) which focuses on the biodiversity, the ecological roles and BCKDHA functions of BSCs in four different sites which differ substantially from each other in terms of soil composition, sea-level, seasonal temperatures and precipitation. An important first step is to identify the photobionts that occur in any particular lichen species. The major goal, therefore, of the present study was determining the biodiversity of green algal photobionts (chlorobionts) of the soil crust lichen Psora decipiens by molecular methods. The crustose green-algal lichen P. decipiens (Hedw.) Hoffm. [Lecidea d. (Hedw.) Ach.], to date described

as being only associated with Asterochloris sp. (Schaper and Ott 2003), is an important component of BSC at all four SCIN locations and provides an opportunity to investigate photobiont heterogeneity within a widespread lichen species. Molecular analysis of the soil crust lichens’ fungal partner is part of another study within the SCIN project. Additionally, we aimed to refine molecular methods to better handle the difficulties that arise in the molecular analysis of soil crust samples because of the presence of multiple organisms. Materials and methods Investigation sites and material Sixty-four samples of the key lichen on soil crusts, P. decipiens together with other species (see Online Resource 1) were collected at the four investigation sites of the SCIN-Project which cover both latitudinal and altitudinal gradients. For more detailed site descriptions and maps please see Büdel et al. (2014). 1. Tabernas field site, SE Spain (37.0127222°, −002.4356389°).

8%) as stage III/IV. Thirty-three of the patients presented with lymph node metastases. This study was approved by the Research Ethics Committee of Shihezi University School of Medicine, P. R. China. Written informed consent was obtained from all of the patients. All specimens were handled and made anonymous according to the ethical and legal standards. DNA isolation and bisulfate conversion DNA was isolated

from 10 tissue sections of 10 μm thickness by proteinase K digestion and a tissue DNA extraction RG7420 solubility dmso kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer’s protocol. As an internal control, all purified genomic DNA samples were successfully tested by polymerase chain reaction (PCR) with human β-actin primers For: 5′-CAGACACCATGGTGCACCTGAC-3′ and Rev: 5′-CCAATAGGCAGAGAGAGTCAGTG-3′, indicating that the suitable quality and quantity of DNA can be used to detect the profile of miR-34a methylation. Genomic DNA was stored at −20°C until use as a template for each PCR reaction. The genomic DNA was treated with bisulfite through an EZ DNA Methylation KitTM according to the manufacturer’s instructions (Zymo Research, Orange, this website CA, USA) (Catalog No. D5001). This treatment combines bisulfate conversion and DNA clean-up. The converted DNA was measured by an ND-1000 spectrophotometer (NanoDrop Technologies,

Inc., Wilmington, DE, USA). Quantitative analysis of DNA methylation The sequence of the CpG island was identified by the UCSC genome browser (http://​genome.​ucsc.​edu/​).

Given that the genomic region upstream the p53 binding site in the miR-34a gene revealed a prominent CpG island, we selected Megestrol Acetate the area with proximal promoter activity in previous experiments [22]. The analyzed region and the CpG sites of the miR-34a promoter are shown in Figure 1. We designed primer sets for the methylation analysis of the miR-34a promoter region by EpiDesigner software (http://​epidesigner.​com; Table 1). For each reverse primer, an additional T7 promoter tag was added for in vivo transcription, and a 10-mer tag was added to the forward primer to adjust for differences in melting temperature. The DNA methylation of miR-34a was quantitatively analyzed by the MassARRAY platform (SEQUENOM) as previously described [25]. The 5 μl PCR mixture contained 10 ng of bisulfite-treated DNA, 25 mM dNTP, 0.2 U of Hot Start TaqDNA polymerase (Sequenom, Sequenom Inc., San Diego, CA, USA), and a 1 μM mixture of forward and reverse primers. The cycles included pre-heating at 94°C for 4 min, followed by incubation for 45 cycles of 94°C for 20 s, 62°C for 30 s, and 72°C for 60 s and then by incubation at 72°C for 3 min. Two microliters of a shrimp alkaline phosphatase (SAP) mix containing 1.7 μl of H2O and 0.3 μl (1.7 U) of SAP (Sequenom) was added to digest redundant dNTPs with the following program: 37°C for 20 min, 85°C for 5 min, and 4°C thereafter.

CrossRefPubMed 49. Carne

PW, Frye JN, Robertson GM, et al.: Stents or open operation for palliation of colorectal cancer: a retrospective, cohort study of perioperative outcome and long-term survival. Dis Colon Rectum 2004, 47:1455–1461.CrossRefPubMed 50. Saida Y, Sumiyama Y, Nagao J, et al.: Long-term prognosis of preoperative “” bridge to surgery”" expandable metallic stent insertion for obstructive colorectal cancer: comparison with emergency operation. Dis Colon Rectum 2003,46(Suppl 10):S44-S49.PubMed 51. Cennamo V, Fuccio L, DAPT Mutri V, Minardi ME, Eusebi LH, Ceroni L, Laterza L, Ansaloni L, Pinna AD, Salfi N, Martoni AA, Bazzoli F: Does stent placement for advanced colon cancer increase the risk of perforation during bevacizumab-based therapy? Clin Gastroenterol Hepatol 2009,7(11):1174–1176.CrossRefPubMed 52. Cheung HYS, Chung CC, Wong WW, et al.: Endolaparoscopic approach vs. conventional open

surgery in the treatment of obstructing left-sided colon cancer. Arch Surg 2009,144(12):1127–1132.CrossRefPubMed 53. Martinez-Santos C, Lobato RF, Fradejas JM, Pinto I, Ortega-Deballon P, Moreno-Azcoita M: Self-expandable stent before elective surgery vs. emergency surgery for the treatment of malignant colorectal obstructions: comparison of primary anastomosis and morbidity rates. Dis Colon Rectum 2002, 45:401–406.CrossRefPubMed 54. Ng KC, Law WL, Lee YM, Choi HK, Seto CL, Ho JW: Self-expanding metallic stent as a bridge to surgery versus emergency resection for obstructing left sided colorectal cancer: a selleck products case-matched study. J Gastrointest Surg 2006, 10:798–803.CrossRefPubMed Mannose-binding protein-associated serine protease 55. Tilney HS, Lovegrove RE, Purkayastha S, Sains PS, Weston-Petrides GK, Darzi AW, et al.: Comparison of colonic stenting and open surgery for malignant large bowel obstruction. Surg Endosc 2007, 21:225–233.CrossRefPubMed 56. Fernández-Esparrach

G, Bordas JM, Giráldez MD, et al.: Severe Complications Limit Long-Term Clinical Success of Self-Expanding Metal Stents in Patients With Obstructive Colorectal Cancer. Am J Gastroenterol 2010,105(5):1087–1093.CrossRefPubMed 57. Fuccio L, Repici A, Cennamo V: Concerns on the very high complication rates reported after self-expanding metal stent (SEMS) placement for colorectal cancer in a Catalan retrospective study. Am J Gastroentero 2010,105(7):1670. author reply 1670–1CrossRef 58. Targownik LE, Spiegel BM, Sack J, Hines OJ, Dulai GS, Gralnek IM, et al.: Colonic stent vs. emergency surgery for management of acute left-sided malignant colonic obstruction: a decision analysis. Gastrointest Endosc 2004, 60:865–874.CrossRefPubMed 59. Singh H, Latosinsky S, Spiegel BM, Targownik LE: The cost-effectiveness of colonic stenting as a bridge to curative surgery in patients with acute left-sided malignant colonic obstruction: a Canadian perspective. Can J Gastroenterol 2006, 20:779–785.PubMed 60.