Although ROS is known to cause DNA damage, it also attacks cell

membranes through formation of lipoperoxide (16,17). To explore the possibility that damage to DNA is responsible for the high sensitivity of V. vulnificus to ROS, we examined cytotoxic agents known to be highly specific for DNA, namely, UV, mitomycin C, and methyl methane sulfonate, for their killing effect on V. vulnificus and E. coli. We found that all of these agents kill V. vulnificus much more efficiently than they do E. coli (Fig. 4). Thus, we showed that cells of V. vulnificus are more susceptible to DNA-damaging agents, including Pexidartinib ROS, than are those of E. coli. The primary aim of the present study was to substantiate the remarkable but solitary report of successful HBO treatment of an advanced case of severe V. vulnificus infection (7). Our findings described herein seem to have achieved this purpose. First, we clearly demonstrated the efficacy of HBO treatment alone in a mouse footpad infection model, a beneficial effect being present without chemotherapeutic or surgical

selleck interventions (Fig. 1). In addition, HBO brought about marked viability loss in cells of V. vulnificus in vitro, whereas we did not observe such an effect with E. coli (Fig. 2a). These results support the notion that HBO is an effective therapy for human infections caused by V. vulnificus. However, we wish to emphasize that our observations do not necessarily encourage the use of HBO alone in the treatment of human cases. Rather, HBO therapy should be regarded as a powerful adjunct modality, not only for clostridial gas gangrene (1,2) but also for severe V. vulnificus infection. However, we should be alert for oxygen toxicity, a well-known side effect of HBO, when using HBO against this infection. Two different mechanisms have so far been proposed for the effectiveness of HBO in the treatment of infectious diseases. One is the direct action of oxygen on the offending microbes and the

other is the indirect effect of increased amounts of dissolved oxygen in plasma and infected tissue (1, 2). As to the direct effect of HBO on bacteria, its in vitro bactericidal activity against the obligate anaerobe Clostridium perfringens has been well established (9, 18). Against facultative bacteria, HBO appears to be mostly bacteriostatic as so far studied (19–21), with the exceptions of its bactericidal effect on Vibrio cholerae (comma) (19) and Pseudomonas Depsipeptide solubility dmso aeruginosa (20). On the other hand, the indirect mechanism may include increased microbicidal activity of leucocytes (22) as well as the anti-inflammatory and anti-edemic effects of oxygen, which would help accelerate wound healing (23). One of the interesting aspects of the present study is the mechanism by which the facultative bacterium V. vulnificus behaves as an oxygen-sensitive organism under HBO conditions. Possibly, there is a difference between V. vulnificus and E. coli in oxygen tolerance, which is not manifest in the air, but becomes evident under HBO.

[49] In rats and mice, the HPA axis expresses important differences from that found in humans. For example, the major product of HPA axis activation in humans is cortisol, while that in most rodents is corticosterone.[50] Moreover, the development of the fetal adrenal gland in rats and mice is markedly different with major relative deficiencies in important enzymes and preference for different substrates. In these species, SRT1720 manufacturer the response to stress may lead to fundamentally different means of pregnancy failure, including a decreased level of circulating progesterone.[51] While

rodent models may not be ideal for the examination of the role of HPA axis in normal pregnancy, evolving rodent models may be of interest in understanding the interaction of the HPA axis and stress in parental behavior.[52] Sheep have been used as a model of maternal[53] and fetal HPA axis function during pregnancy. In this animal model, it is the development and activation of the fetal HPA that is the primary driver of parturition,[54] and stresses such as hypoxia activate the HPA axis in sheep and lead to preterm labor.[55] The maternal–fetal interface in humans includes close contact

between maternal and fetal cells not only within the placenta and uterus[8] but also within the maternal and fetal circulations, as cellular traffic has been shown in either direction.[56, 57] The expression of proteins unique to the mother on fetal cells has raised a decades-long MLN2238 concentration debate over the critical pathways and mechanisms needed to assure both immune tolerance

Grape seed extract and protection of the fetus from infection.[58] Humans can mount an immune response against fetal antigens during pregnancy,[59] and it is clear that there is an intricate interaction between maternal immune cells and trophoblast.[60, 61] This interaction may be of benefit to the evolving conceptus[62] or may be involved in early pregnancy loss or other adverse pregnancy outcomes.[63] Activation of local innate immunity within the myometrium is thought to play a role in parturition[64] and in premature uterine contractions.[65] In humans, certain pathogens are more deleterious during pregnancy as compared to the non-pregnant state,[66] while others are not,[67] and the role of the placenta as a safe harbor for evolving pathogens has been described.[68] Some infection syndromes that occur in humans occur only under contrived conditions in animals.[69] Moreover, some organisms, such as CMV, are different in different hosts.[70] Both the peculiarities of the immune response and the infectious agent must be taken into consideration when using an animal model to understand the function of the immune response during pregnancy.

02; 95% CI 1.50–12.0; P = 0.0051). As compared with the group without early AKI, the urinary L-FABP level in early AKI group was significantly higher not only on the day of SCT

but also at the baseline. Then, ROC analysis demonstrated the urinary L-FABP level at baseline had good discriminative ability for the early AKI. Conclusion: One-quarter of allogeneic PI3K inhibitor SCT recipients developed the early AKI, which was linked with increased risk of their short-term mortality. Antecedent kidney damage, which can be identified by urinary L-FABP concentration, may portend the emergence of early-onset AKI. YAMASHITA TETSUSHI1, DOI KENT2, TSUKAMOTO MAKI1, NANGAKU MASAOMI1, YAHAGI NAOKI2, NOIRI EISEI3 1Department of Nephrology and Endocrinology, Graduate school of Medicine, The University of Tokyo; Vismodegib ic50 2Department of Critical Care Medicine, The University of Tokyo Hospital; 3Department of Hemodialysis and Apheresis, The University of Tokyo Hospital Introduction: Tissue inhibitor of metalloproteinases-2 (TIMP-2) has recently been reported to detect severe AKI better than new AKI biomarkers that have recently introduced to the clinical such as NGAL. Methods: This study enrolled 98 patients who were admitted to the adult mixed ICU of The University of Tokyo Hospital from July 2011 to October 2011 by consecutive sampling. Urine TIMP-2 and NAG, and plasma NGAL and IL-6 were measured

on ICU admission. This MAPK inhibitor study was aimed to evaluate whether these biomarkers

could predict AKI and its severity, and mortality by ROC analysis. Results: AKI occurred in 42 (42.9%) patients including 27 (27.6%) severe AKI (KDIGO stage 2 or 3). The area under the ROC curve for each marker was shown in Table. Forty one (41.8%) patients was complicated with sepsis, including 19 (19.4%) severe AKI. In accordance with previous reports, plasma NGAL and IL-6 were increased by sepsis, however urine TIMP-2 and NAG was increased not by sepsis but by the presence of severe AKI (Figure). In-hospital mortality was 15.3% in this cohort and urine TIMP-2 and NAG, and plasma NGAL were significantly higher in the non-survivors than the survivors, whereas plasma IL-6 was not significantly associated with mortality. Conclusion: A new urine biomarker of TIMP-2 is increased especially in severe AKI and associated with mortality. Sepsis appeared to have a smaller impact on urine TIMP-2 and NAG compared with plasma NGAL and IL-6. This distinct feature of biomarkers will enable to evaluate the contribution of sepsis to the development of AKI. TANAKA YUKI1, KUME SHINJI1, MAEDA SHIRO2, OSHIMA ITSUKI3, ARAKI HISAZUMI1, ISSHIKI KEIJI1, ARAKI SHIN-ICHI1, UZU TAKASHI1, MAEGAWA HIROSHI1 1Department of Medicine, Shiga University of Medical Science, Japan; 2Laboratory for Endocrinology, Metabolism and Kidney diseases, RIKEN Center for Integrative Medical Science, Japan; 3Discovery Research Laboratories, Shionogi & Co., Ltd.

Dussurgey and T. Andrieu) of the SFR Biosciences Gerland-Lyon Sud (UMS3444/US8), the Laboratoire P4-Jean Mérieux team for access to BSL4 facilities, and T. Walzer for helpful discussions. The authors declare no financial or commercial conflict of interest. “
“Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, 9 Cambridge Center, Cambridge, MA 02142, USA Department of Medicine, Division of Rheumatology, University of Massachusetts Medical School, Worcester, MA 01655, USA Department of Microbiology, Mount Sinai School of Medicine, 1 Gustave Levy Place, New York, NY 10029, USA Crosslinking of Fc γ receptor II B (FcγRIIB) and the BCR by immune complexes (IC) can downregulate antigen-specific

B-cell responses. Accordingly, FcγRIIB deficiencies have been associated with B-cell hyperactivity in patients with systemic lupus erythematosus and mouse models of lupus. However, we have previously shown that murine Raf inhibitor drugs IgG2a-autoreactive AM14 B cells respond robustly to chromatin-associated IC through a mechanism dependent

on both the BCR and the endosomal TLR9, despite FcγRIIB coexpression. To further evaluate the potential contribution of FcγRIIB to the regulation of autoreactive B cells, we have now compared the IC-triggered responses of FcγRIIB-deficient and FcγRIIB-sufficient https://www.selleckchem.com/products/poziotinib-hm781-36b.html AM14 B cells. We find that FcγRIIB-deficient cells respond significantly better than FcγRIIB-sufficient cells when stimulated with DNA IC that incorporate low-affinity TLR9 ligand (CG-poor dsDNA fragments). AM14 B cells also respond to RNA-associated IC through BCR/TLR7 coengagement, but such BCR/TLR7-dependent responses are normally highly dependent on IFN-α costimulation. However, we now show that AM14 FcγRIIB−/− B cells are very effectively activated by RNA IC without supplemental IFN-α priming. These results demonstrate that FcγRIIB can effectively modulate both BCR/TLR9 and BCR/TLR7 endosomal-dependent activation of autoreactive B cells. Fc γ receptors (FcγR) play a major

role in the regulation of Ab-dependent effector mechanisms. Most FcγR+ cells express both activating and inhibitory receptors, and the magnitude and nature of the immune response depend on the balance of signals transmitted by each cell-specific combination of signals. By contrast, B cells express only the inhibitory receptor Fc γ receptor II B (FcγRIIB), and Non-specific serine/threonine protein kinase here it is believed to downregulate responses to antigens already bound by Ab 1. In accordance with its suppressive function, mice with a deletion in the FcγRIIB gene develop enhanced humoral responses to both foreign 2 and self-antigens 3. The level of FcγRIIB expression has been further correlated with systemic autoimmune disease in both animal models and patient populations. Systemic lupus erythematosus-prone mice such as NZB, BXSB and MRL/lpr inherently express lower than normal levels of FcγRIIB in activated or germinal-center B cells, due to polymorphisms in the FcγRIIB gene promoter 4.

CFB qRT-PCR was performed as described previously 4, using the Universal Probe Library (UPL♯1, Roche Diagnostics GmbH, Mannheim, Germany). Primers of CFB

were forward: CTCGAACCTGCAGATCCAC; reverse: TCAAAGTCCTGCGGTCGT. The expression of iNOS gene in macrophages was detected by SYBR Green method using the LightCycler® 480 system. The primers of iNOS gene used here were as follows: forward: ggcaaacccaaggtctacgtt; reverse: tcgctcaagtccagcttggt. Expression levels were first normalized to the GAPDH mRNA level and then calculated as fold changes of comparator samples. Three mice from the second experiment (i.e. CRIg-Fc injection from day 18 to day 24 p.i.) were used for immunohistochemistry study. Freshly collected eyes were embedded in OCT medium (Miles). Apoptosis Compound Library Cryosections of mouse eyes were fixed with 2% paraformaldehyde (Agar Scientific, Cambridge, UK) for 15 min buy SB431542 at room temperature. After thorough wash, samples were blocked with 5% BSA for 30 min and were then incubated with biotinylated anti-mouse complement C3d (1:100, R&D System) or goat anti-human CFB polyclonal antibody

(1:100, Santa Cruz Biotechnology, CA, USA), or biotinylated anti-mouse F4/80 (Serotec, Oxford, UK), or rat anti-mouse CRIg (14G6, gifted by Dr. Menno van Lookeren Campagne in Genentech) for 1 h, followed by FITC-conjugated streptavidine or FITC-conjugated anti-goat IgG (both from BD Biosciences, Oxford, UK), or APC-conjugated streptavidine (BD Bioscience) or FITC-conjugated anti-rat Ig (Serotec) for a further hour. Samples were washed and mounted with Vectashield Mounting Medium with PI (Vector Laboratories, Peterborough, UK) and were examined with a LSM510 confocal microscope (Carl Zeiss Meditc, Gottingen, Germany). The effect of in vivo CRIg-Fc treatment on T-cell proliferation was carried on unfractionated spleen cells of IRBP-immunized mice, treated with or without CRIg-Fc (from day 1 to day 22 p.i.). Cells (1×105) were incubated in 96-well plates, unstimulated, or stimulated with 25 μg/mL of IRBP 1–20 for 72 h in complete RPMI 1640 medium (containing 10%

heat-inactivated Verteporfin ic50 FCS, Sigma-Aldrich). Cells were then pulsed with 0.5 mCi/well [3H] thymidine overnight and radioactivity was measured. To test whether CRIg-Fc can suppress cell proliferation in vitro, spleen cells from control EAU mice were incubated in 96-well plates in RPMI 1640 complete medium treated with 2.5 μg/mL of Con A or 25 μg/mL of IRBP peptide in the presence or absence of different concentrations of CRIg-Fc. After 72 h incubation, the cells were pulsed with 0.5 μCi/well [3H] thymidine overnight, and radioactivity was then measured as above. Splenocytes from EAU control or CRIg-Fc-treated mice were cultured with RPMI 1640 complete medium in 96-well plates in the presence or absence of 25 μg/mL IRBP 1–20 peptides for 48 h.

These results suggested that the construct might have been submitted through the germline although no proof for genome integration was obtained. Taken together, PF-01367338 concentration the articles by Heyers et al. and Beckmann et al. (12,18) show proof of principle that it might be possible to enter the germline using transformed miracidia. A further publication by Wippersteg et al. (19) reports the tissue-specific

expression of GFP driven by the promoters of two S. mansoni protease genes cathepsin L1 and cathepsin B2. As predicted from earlier reports (20), the S. mansoni cathepsin L1 promoter drove GFP expression throughout the gut whereas transformation with the SmCB2 (21) construct resulted in GFP fluorescence localized in the tegument. Particle bombardment was also employed by Beckmann et al. (18). Here, different reporter gene constructs using the S. mansoni actin1 regulatory elements and GFP as reporter KU57788 gene were used for transient transformation of adult males and sporocysts. A 445-bp promoter fragment was sufficient for transcription initiation in larvae or adults as confirmed by confocal microscopy. Actin gene characteristic TATA, CArG and CAAT boxes were identified in the promoter, suggesting that it is functionally conserved between vertebrates and invertebrates. However, a vertebrate-specific intron containing an additional regulatory CArG box was not found indicating that

the regulation of SmAct1 transcription depends exclusively on its promoter region. In addition, the authors showed GFP expression in the tegumental area, especially the tubercles, in the muscle tissue

and weakly in the parenchyma of the male worms. The most recent publication describing the transfection of schistosomes second using biolistic methods was only published last year (22). Here, modified reporter gene constructs containing 5′ and 3′ regulatory regions of protease genes (cathepsins F and D) were used to transfect immature adult worms. The results obtained showed that there was a minor improvement of the intensity and distribution of the reporter signal in constructs containing parts of the ORF and/or 3′ gene-specific genomic fragments. However, reporter signals were found in tissues other than the gut and the authors suggest that this might represent dysregulated transcription which could impact on the utility of biolistics as a tool to accurately profile spatial expression of transgenes. Electroporation as a tool to introduce plasmid-based DNA constructs was tested in S. japonicum and S. mansoni (23,24). Yuan et al., using a commercial plasmid (pEGFP-C1), showed that the cytomegalovirus (CMV) promoter was able to drive EGFP expression in primary cell cultures of S. japonicum. Introduction of the plasmid into schistosomula and adult worms by electroporation led to EGFP expression as demonstrated by RT-PCR, Western blotting and confocal microscopy with EGFP fluorescence detectable along the tegumental surface of the worms (24).

The mean age was 42.9 years at time of transplant. For seven patients, the allograft thrombosis was their first kidney transplant and seven of the nine cases had a deceased donor transplant. The initial transplants functioned for this website a mean of 1.67 days and the patients received a second allograft at a mean of 3.1 days after graft failure. All of the re-transplants worked immediately. Four allografts failed after a mean of 52.5 months (2–155 months). Two of these died with

a functioning allograft, one failed owing to chronic allograft nephropathy and one owing to persistent acute cellular rejection. The remaining five patients still have a functioning allograft after a mean of 101.8 months (7–187 months). One year allograft and patient survival after re-transplantation were 87.5% and 100% respectively (after 5 years, both were 57%). Immediate re-transplantation following early kidney transplant thrombosis RG 7204 can be a success. It may be considered in selected cases after allograft thrombosis. “
“Apolipoprotein A-I amyloidosis is a rare, autosomal dominant disorder characterized by progressive accumulation of amyloid fibrils in tissues, leading to renal and hepatic disease. We describe the clinical manifestations and pathologic features of kidney disease in three Irish families. This observational

study examines all known cases of chronic kidney disease due to hereditary apolipoprotein A-I amyloidosis in Ireland. Patients were identified by physician interview. In all of the affected individuals the disease was caused by the Gly26Arg heterozygous mutation. Immunohistochemistry confirmed that amyloid deposits were composed of apolipoprotein A-I fibrils. Family trees and clinical data were obtained via analysis of patient

medical records. The vast majority of affected cases had demonstrable kidney disease, with variable liver disease. Renal disease buy Ribociclib most commonly manifested as slowly progressive renal impairment with mild proteinuria. In one kindred, a severe, debilitating peripheral neuropathy was common among affected family members. Histology demonstrated tubulointerstitial fibrosis with amyloid deposition in the medulla. There was very high penetrance within affected families. Of five patients who were transplanted, one transplant was lost after 5 years due to recurrent disease. One patient died from sepsis shortly after transplant. Hereditary apolipoprotein A-I amyloidosis is characterized by slowly progressive renal disease. Amyloid is deposited in the renal medulla highlighting the need to examine the medulla on renal biopsy. Overall, kidney transplantation conferred a survival advantage. “
“We recommend that in patients with chronic kidney disease (CKD), end-stage renal failure (ESRF) and after kidney transplantation, that guidelines for revascularization of the general population be adhered to (1D).

RNA analysis indicated that mhuA and mhuB are each transcribed from individual Fur-regulated promoters. selleck screening library Moreover, RNA analysis of an mhuB deletion mutant and a promoter reporter assay coupled with β-galactosidase suggested that MhuB could function as an activator for mhuA transcription. Finally, the role of MhuA as the heme/hemoglobin receptor was confirmed by construction of an mhuA deletion mutant and its complemented strain followed by growth assay. Iron is an element integral to the growth of almost all bacteria.

However, the availability of iron for bacteria is limited because it is usually present as insoluble ferric hydroxide polymers in an aerobic environment or bound to iron-binding proteins such as transferrin and lactoferrin in mammalian hosts (1). Therefore, most bacteria have

evolved the ability to acquire iron under iron-restricted conditions. Numerous bacteria produce and secrete siderophores (low-molecular weight iron-binding chelators) which can remove ferric iron from iron-binding proteins. In Gram-negative bacteria, ferric ion complexed with siderophore (ferrisiderophore) is transported into cells via a TonB-dependent specific uptake system, consisting of an outer membrane receptor protein and an ABC transporter (2). In addition, certain bacteria acquire heme as a nutritional iron source by a TonB-dependent system, similar see more to those for ferrisiderophores, which includes the binding of heme or heme-containing proteins such as hemoglobin to the cell surface receptor, followed by transport of the intact heme moiety into the cell (3). Siderophores are unable to remove the iron from heme. Moreover, when intracellular iron concentrations are high, expression of those systems studied to Hydroxychloroquine date is negatively regulated at the transcriptional level by a global iron-binding repressor protein called Fur (ferric uptake regulation) with ferrous ion as a corepressor, (4, 5). V. mimicus was first described as a group of biochemically atypical strains of V. cholerae

(6) but they share some pathogenic factors such as enterotoxins and hemolysins (7). V. mimicus, like other pathogenic Vibrio species, inhabits environmental water, including river, brackish, and sea water, and causes diarrhea through eating fish and shellfish contaminated with the bacterium (8). The present authors have previously reported that V. mimicus secretes the siderophore aerobactin in response to iron restriction (9), and that the iucABCD genes engage in aerobactin biosynthesis. They have also reported that the ferriaerobactin complex is incorporated into the cytosol via the 77-kDa IROMP, IutA, and the ABC transporter, MatCDB (10). V. mimicus also expresses 80-kDa IROMP under iron-restricted conditions (9). Hence, V. mimicus is expected to use at least one other iron source besides ferriaerobactin. Although many Vibrio species, including V.

Oral tolerance likely evolved as an analog of self tolerance, in order to prevent hypersensitivity reactions to foods and commensal bacteria. Oral tolerance is a continuously developing immunological process, stimulated by exogenous antigens which enter the gut. Due to their preferential access to the internal medium, antigens entering via the gut represent a special

category of antigens, at the border between self and non-self. Dietary CYC202 purchase tolerance thus becomes a form of peripheral tolerance, a process by which food antigens and commensal microorganisms are considered a future part of the self (30). There are two main pathways for inducing oral tolerance: stimulation of the development of Tregs to an antigen which has been eaten, and clonal anergy of effector cells which might react to a particular antigen (31). The most important factor determining what kind of tolerance will develop is the antigen dose (32). Small doses of oral antigen favor the development of Tregs, while larger doses lead to deletion of active clones. Small doses lead to antigen presentation through dendritic cells belonging to the gut-associated lymphoid tissue, with consequent increased synthesis of regulatory cytokines, such as IL-10, TGF-β and IL-4 (33). Afterwards, these dendritic cells migrate to local lymph nodes, where they suppress immune responses by inhibiting effector cells through regulatory cytokines.

These cytokines act not only on effector cells which recognize the antigen presented by the tolerogenic dendritic

cells, but also on effector Dorsomorphin mw cells from the immediate proximity, inside the lymph node (bystander suppression) (34). As previously shown by Lonnqvist et al., treatment of G protein-coupled receptor kinase neonatal mice with orally administered SEA promotes the development of oral tolerance to OVA when it is fed to adult mice (Fig. 1) (35). SEA, one of the strongest known T-cell mitogens, does not reverse, but rather augments, the tolerogenic type of intestinal immune responses. SEA binds to the TCR of IELs and to the MHC-II of the dendritic cells which cross the epithelium to take up samples from the intestinal lumen. The result is excessive stimulation of IELs, with increased local IFN-γ production, probably through a MyD88-dependent mechanism (36). IFN-γ stimulates normal enterocytes to process peptides rapidly for presentation through MHC-II (37). Although enterocytes are not professional antigen presenting cells, it has been found that they participate in the development of oral tolerance by production of MHC-II-associated peptides (38). Such production occurs, not only when stimulated by SEA or other inflammatory stimuli, but also physiologically, in which case it is at a lower rate (39). MHC-II-associated peptides can be presented directly to CD4+ lymphocytes (40) or packed in the form of corpuscles, or small cellular fragments, which detach from the basal poles of enterocytes.

There was an increase in the TNF-α mRNA in the peritoneal cells stimulated with live M. tuberculosis or PPD. In fact, with the live M. tuberculosis stimulation the mRNA expression was sustained beyond 12 h with a further increase at 24 h compared to PPD. Previous reports from our laboratory have shown clearly that after aerosol challenge with virulent M. tuberculosis Stem Cells inhibitor (H37Rv), high levels of TNF-α mRNA expression were evident in the laser capture micro-dissected discrete granulomatous lesions in non-vaccinated, but not in BCG-vaccinated guinea pigs [41,43]. This was also evident when peritoneal, bronchoalveolar lavage cells, spleen or lung digest cells from M.

tuberculosis-infected guinea pigs were restimulated in vitro with PPD [26,42]. However, recent reports have indicated that secretion of TNF-α was dependent on the virulence of M. tuberculosis, as cytokine (TNF-α, IL-6, IL-10) or chemokine [growth-regulated oncogene (GRO)-α] secretion was found to be reduced significantly when human macrophages or dendritic cells were infected with the Beijing strains of M. tuberculosis

compared to the H37Rv strain [44]. Patients infected with Beijing strains were more prone to disease progression, had higher risk of extrapulmonary tuberculosis or were less likely to respond to treatment [45,46]. Previous studies from our laboratory have indicated that in vitro Carfilzomib cost treatment of peritoneal or alveolar macrophages with rgpTNF-α enhanced the TNF-α and IL-12p40 mRNA expression [24,25]. Again, other studies as well as ours have demonstrated SPTLC1 that TNF-α alone or in combination with rgpIFN-γin vitro-induced expression of MHC class II molecules on macrophages and T cell IL-2 receptors [25,47,48], although TNF-α injection had no effect on MHC class II expression. It is quite possible that TNF-α had an immediate effect on MHC class II expression,

but the effect was not long-lasting until 6 weeks of vaccination. In vitro studies have also shown that TNF-α alone or together with IFN-γ induced an enhanced expression of IL-10 mRNA in peritoneal macrophages from BCG-vaccinated guinea pigs [25]. Injection of TNF-α may be causing intrinsic changes in macrophages in the BCG-vaccinated guinea pigs, as it is known that TNF-α is essential for the differentiation of macrophages into epithelioid cells and in the aggregation of leucocytes into functional granulomas for controlling virulent mycobacterial infection [34]. Clearly, TNF-α injection caused a better clearance of M. bovis BCG in the lymph nodes of these guinea pigs. These results indicate that in vivo administration of rgpTNF-α decreased M. bovis BCG CFUs, increased the PPD skin test response and the proliferative ability of T cells and altered cytokine mRNA expression, thus modulating the function of both T cells and macrophages in guinea pigs after M.